Southern Blotting & Detection of sickle cell disease: - Please label the figure and discuss each lane, and draw a Punnett square. - Finally, discuss the results at length.

Q: explain briefly what kind of browning reactions that may potentially be occuring in cooking ground p...

A: Browning is the process of food turning brown as a result of internal chemical reactions. Browning i...

Q: What were the major developments that facilitated the current level of acceptance of a possible link...

A: Violence: it is an extreme type of aggression. 

Q: 5

A: Recombinant forms of Oestrogen and Progesterone are used in post menopausal women. Recombinant insul...

Q: ans develop from the neural tube and neural crest

A:

Q: Match the sense orgs with the type of stinulus they are able to detect Ooo mouth (Choose) ight chemi...

A: Stimulus(plural)/Stimuli(Singular) Any change in an organism's environment that causes to the organi...

Q: 50 um

A: Meiosis is of two types Meiosis 1 Meiosis 2 * Meiosis 1 has the following stages Prophase 1 Metap...

Q: Which of the following statements accurately describes the pattern of recruitment in a muscle when p...

A: The contraction of muscle is responsible for the development of muscle movement. The generation of s...

Q: In a recent study, scientists used gene editing to treat both sickle cell disease and beta-thalassem...

A: Sickle cell disease and beta thalassemia are genetic disorders caused by errors in genes of haemoglo...

Q: Why are GMOS considered a threat to the environmental safety?

A: Introduction In this question we have to discuss why GMOs considered a threat to the environmental s...

Q: What factor could have been responsible for the changes in the population's age structure? Use the s...

A: The population age structure of a country or region is the distribution of its people's ages. This c...

Q: n Figure 6-6, assess the allele Vfwith respect to the Vbyallele: is it dominant? recessive? codomina...

A: Genetics is a branch of the biology involved in the study of genes, genetic variation, and heredity ...

Q: the treatment that utilizes transgenic organisms to mass-produce proteins O stem cell therapy O gene...

A: Recombinant DNA technology plays a major role in modifying the genetic setup of an organism to have ...

Q: Describe how hair cells work in general, and in the fish lateral line system.

A: Lateral line system  It is a type of sensory system found in fishes and aquatic amphibians. This sys...

Q: What are some uses/applications of transgenic organisms?

A: Applications of animal transgenesis may be divided into three major categories: (i) to obtain inform...

Q: When comparing evolutionary similarities between different genes within a gene family, it is usually...

A: DNA is a basic hereditary molecule that carries information related to the person. 

Q: If you are a strong taster, how many bands would you expect on the gel after electrophroesis? O1 O2 ...

A: Strong taster is the person who gets the taste of food stronger than average people they are called ...

Q: H* ions generated by reactions in the electron transport chain, as well as H* ions present in the ma...

A: The electron transport chain is a series of reaction in  four protein complexes, taht creating an el...

Q: How did the scientific community learn that DNA replication takes place in a semi-conservative fashi...

A: DNA replication is the process by which DNA makes exact copies of itself.  Several models of DNA rep...

Q: As coral reef communities continue to experience ocean acidification and bleaching, a population of ...

A: There are many reasons for decline in coral reef communities. The first and foremost being the human...

Q: What is the common feature of RTKS: O cysteine rich domains SS binding of external proteins O trysos...

A: Tyrosine kinase domain

Q: Black body (b) and purple eye (pr) are recessive autosomal mutations in Drosophila. Bridges are cros...

A: b - allele for black body - recessive pr - allele for purple eye - recessive B - wild type for body ...

Q: Give the similarities and differences of plants and animals in terms of its: Reproduction, developme...

A: There are lot of differences between plants and animals. The first and foremost difference between p...

Q: Why is leguminous crop rotation used in agriculture?

A: Introduction In this question we will discuss about why leguminous crop rotation is used in agricult...

Q: Repolarization occurs because Multiple Choice more sodium ions diffuse into the cell than potassium ...

A: At the resting stage, the Na+ and K+ channels remain closed.

Q: Define the following terms: Predator Prey Population

A: Introduction: Ecology is the branch of biology that deals with ecosystem (interaction between organi...

Q: Brainstem-Controls breathing and heart rate Test 1: Whole Brains (not to scale) Mouse Cat Baboon Hum...

A: Cerebellum is the part which is located at the back of brain underlying the occipital and temporal l...

Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...

A:   Here,  human DATP gene sequence of human is given , i.e :  ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC

Q: In sweet peas, the synthesis of purple anthocyanin pigment in the petals is controlled by two genes,...

A: In sweet peas, the synthesis of purple anthocyanin pigment in the petals is controlled by two genes,...

Q: Which of the following statements about the mechanism of splicing is correct? 1. A mutation in a 5' ...

A: The mRNA that is produced by the process of transcription undergoes a modification process in order ...

Q: Question 3. An abnormally high levels intracellular tangles are observed to occur in the brains of p...

A: Q3.Tangles are seen in the cytoplasm of dead and dying nerve cells.  They are composed of twisted st...

Q: the 1940’s, a young actress filed a case against a film director, Robin Williams, for parental suppo...

A: Introduction:- The presence or absence of the antigens A and B, which are carried on the surface of ...

Q: The part of the neuron that is usually a single lorg extension that conducts an impulse to a muscle ...

A: Neuron is the nerve impulse producing and transmitting cells in the nervous system. They have the ca...

Q: QUESTION 4 Which of the following antibody specificities would be a likely hypothesis based on the r...

A: Antibody detection test :- This test is used to detect antibodies. 

Q: in only one cell, label the nucleus, cytoplasm, and cell membrane for these two figures. Describe th...

A: 1. It is simple cuboidal epithelial cell , it is located at lines kidney tubules.  Nucleus is presen...

Q: Pathogen A has an ID50 of 10 cells and an LD50 of 10,000,000 cells. Pathogen B has an ID50 of 10,000...

A: Given information Pathogen A ID50 of 10 cells LD50 of 10,000,000 cells Pathogen B ID50 of 10,000 ...

Q: Which temperature is Taq polymerase's optimal temperature O 20 degrees C 72 degrees C 55 degrees C O...

A:

Q: how they can affect the populations

A: Ecology at the organismic level is essentially physiological ecology which tries to understand how d...

Q: A blood culture from a patient is taken for analysis. The potentially diseased blood is then analyze...

A:   Presence of alcohol in body can be done by foreign invaders like bacteria yeast and other microorg...

Q: Meiosis occurs in while mitosis occurs in O somatic cells, germ line cells O germ line cells, somati...

A: Meiosis The mechanism through which sexually reproducing creatures make gametes (sex cells), is a n...

Q: Why are GMOS considered a threat to the environmental safety?

A: GMO stands for Genetically Modified Organism. They are organisms that have had their characteristics...

Q: Why did Staphylococcus aureus appear in golden yellow color. And the way to differentiate between St...

A: Answer : staphylococcus aureus appears golden yellow color because of the carotenoid pigments presen...

Q: What is myocardial infarction (a heart attack)?

A: A muscular organ in most animals that pumps blood through the blood vessels of the circulatory syste...

Q: Four E. coli strains of genotype atb¯ are labeled 1, 2, 3, and 4. Four strains of genotype a¯b* are ...

A:

Q: Write 5 uses of a cladogram (unscaled tree).

A: Cladogram  It is a branching tree diagram showing shared morphological traits between species.

Q: BJE the diploid human chromosome number (2n) =46, what will be the chromosome number per cell in eac...

A: Introduction:   Cell cycle is an ordered sequence of events occurring in a cell. Cell cycle results ...

Q: 1. After exposure to a mutagen an A-T base pairing becomes T-A in the daughter cell. This is an exam...

A: Please note, keeping with the site regulations and in order to provide accurate and detailed answers...

Q: You are studying a small eukaryotic gene of about 2000 bp in length. About how many copies of histon...

A: There are histone octamers found in the genetic arrangement whose knowledge can be used to answer th...

Q: GIVE THE EMBRYOLOGICAL EXPLANATION FOR  "The dorsal mesocardium is a ventral mesentery." please be ...

A: 1 : a ventral mesentery of the undeveloped stomach that endures as the falciform tendon and the less...

Q: List a diversity of ways some simple animals obtain nutrition without a complete digestive tract

A: Biodiversity is an integral part of the biosphere we live in and various animals shows various modes...

Q: After conducting the Gram staining procedures and you observe nothing (you didn’t see anything) in y...

A: Introduction Gram staining, commonly known as Gram's method, is a staining technique that is used to...

Hematology

Hematology is the branch of biology. Hematology is the medical field that deals with the treatment of blood disorders and cancers, such as hemophilia, leukemia, lymphoma, and sickle-cell anemia. Hematologists and hematopathologists are medical professionals who specialize in illnesses of the blood and its components.