Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a sensation of pleasure, special proteins on the surface of nerve cells, called Dopamine Active Transport Proteins (DATP), begin active transport of dopamine back into the nerve cells so that it can be stored for reuse. The DATP gene carries coded information that is used by neurons to make dopamine active transport proteins. 1. The sequence of DNA bases shown on blue "DATP Gene" sheet represent small parts of the DATP gene DATP Dopamine from a human. The letters represent DNA bases in the DATP gene. Dopamine Active Transport Protein (DATP) Genes Human TT ATT CCGG ATCGAT CGAC GGATATA CTCCG|G|TATTA AT C G AT CGAT CGCCGGATATACTCCGGTAATATC Mouse TC Cat TCCGGATCGATCG CCCGATATACTCCTGTAATATC AT Baboon TCCGGATCGATCGCCGGATATTCTC GGTAATATC 2. Circle the DNA bases on the mouse (pink), cat (green), and baboon (yellow) gene sequences (order of A, T, G, and C's) that are different from the human base sequence. 3. Count and record the number of differences in the DNA base sequences on the data table.

Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a sensation of pleasure, special proteins on the surface of nerve cells, called Dopamine Active Transport Proteins (DATP), begin active transport of dopamine back into the nerve cells so that it can be stored for reuse. The DATP gene carries coded information that is used by neurons to make dopamine active transport proteins. 1. The sequence of DNA bases shown on blue "DATP Gene" sheet represent small parts of the DATP gene DATP Dopamine from a human. The letters represent DNA bases in the DATP gene. Dopamine Active Transport Protein (DATP) Genes Human TT ATT CCGG ATCGAT CGAC GGATATA CTCCG|G|TATTA AT C G AT CGAT CGCCGGATATACTCCGGTAATATC Mouse TC Cat TCCGGATCGATCG CCCGATATACTCCTGTAATATC AT Baboon TCCGGATCGATCGCCGGATATTCTC GGTAATATC 2. Circle the DNA bases on the mouse (pink), cat (green), and baboon (yellow) gene sequences (order of A, T, G, and C's) that are different from the human base sequence. 3. Count and record the number of differences in the DNA base sequences on the data table.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 6SQ

See similar textbooks

Similar questions

• select 15 animals that are endemic only to the Philippines. (native and restricted to a certain place) • describe the characteristics of these animals and create a dichotomous key for these animals. Picture below is only a sample.
DNA sequences were analyzed from humans and three other mammals: species X, Y, and Z. Which of these mammals is most closely related to humans? (Note: Regions identical to human DNA are shown in bold type.)
MAKE A simple sketch and label characteristics Choose a human-related organism to study. As you consider strategies to enhance the social value of this organism, think of other desirable attributes that may be added to it. Imagination is a powerful tool, so let it go wild and imagine that you can transfer genes across other animals. For example: A gene from a firefly has been transferred into tobacco plants so that they may glow in the dark, as demonstrated by geneticists. Tobacco pests are less likely to attack at night because of this.
Here is some information about the sequences: All these sequences, “SEQUENCE_21” to “SEQUENCE_27” are in the same subfamily or “clade” of a large phylogenetic alignment of all Rab proteins in these three species (see “Figure 1.pdf” for a full view of gene family in humans, plants and yeast, see the “D” branch towards the bottom of the tree in Figure 1). “SEQUENCE_28” is a different Rab protein (actually it is the Rab39 protein at the bottom of the tree). “SEQUENCE_21” is from yeast. “SEQUENCE_22” to “SEQUENCE_25” are from the plant, Arabidopsis. “SEQUENCE_26” and “SEQUENCE_27” are from humans. Question: Based on the information above, what can you speculate about the possible evolution of the genes that “SEQUENCE_21” to “SEQUENCE_27” represent? (write 5 points at least).
Try to explain these terms do a person who does not have an extensive scientific background. These terms relate to genetic characteristics of microorganisms 1. base pairs, encoding segments or genes, non-encoding segments or pseudogenes, structural RNAs
Individuals within the same species have the different DNA "fingerprint," but individuals from different species have same DNA fingerprints. Select one: True False
Compare and contrast, Jaccard's similarity index, Sorensen and Bray-curtis
Using evidence from the text, how can natural selection determine the survival of humans during the current COVID-19 pandemic? Please explain in 2-3 sentences. In your response, use the words: genetic variants/genes, natural selection, favorable traits This must follow a CER format (claim, evidence, reasoning)
Dr. Olivera describes how cone snail shell similarities are a proxy for relatedness but describes how this works on a molecular level with the construction of a phylogenetic tree from the ribosomal DNA sequence comparisons. Group of answer choices True False
Which of the following would be most useful for comparing ALLknown groups of organisms?a. DNA encoding ribosomal RNAb. DNA encoding the keratin proteinc. Mitochondrial DNAd. Y chromosome DNA
A graduate student, Dolt Colt, at The Best Western University synthesized a drug called Drug X and noted that it lowered blood cholesterol levels in mice. He tried to see if it works in humans. Is it: Replicability Reproducibility Generalizability Translatability Transparency Rigor
What is a genome? Group answers: a. The complete collection of an organisms genetic information b. The number of chromosomes found in each cell c. All the genes found in a population d. The combination of proteins and DNA found in the sex cells