Q: a. b. What constitutes the protein-coding region of a mature mRNA molecule?
A: INTRODUCTION The process of copying a segment of DNA into mRNA known as transcription. In the DNA…
Q: Describe the major climate during your time era. Climate mainly includes average temperatures and…
A: Climate:- Climate is defined as conditions prevailing in an area for a long period of time.
Q: 49. In a certain country in 2008, there were 275 deaths due to maternal causes. There were 1,750,000…
A: Maternal mortality ratio = (Number of maternal deaths / Number of live births) X 100,000 This ratio…
Q: Enumerate and briefly explain four major factors that influence the ability of the female to produce…
A: Egg production can be affected by such factors as feed consumption (quality and quantity),water…
Q: Reproduction is usually sexual with both male and female sexes, however asexual reproduction does…
A: Reproduction It is a process leading to the formation of an organism that may or may not be similar…
Q: Give different between Microphyllus and Macrophyllus woody plant
A: The main difference between microphylls and macrophylls is that 1. microphylls are leaves having a…
Q: ELEMENTS PRESENT EXAMPLES FUNCTIONAL GROUP BIOMOLECULES FOUND 1. 2. 3. СООН 4. Monosaccharide…
A: The method of electrophoresis is used to separate biomolecules based on particle charge, particle…
Q: 7) Describe in detail the mechanism by which the major spliceosome removes introns from pre-mRNA…
A: Spliceosome is a complex small nuclear RNA protein molecule also called snRNA that helps to remove…
Q: 21. Which macromolecules always contain carbon, hydrogen, oxygen, nitrogen, and sulfur? A. nucleic…
A: Introduction:- Any exceedingly big molecule with a diameter ranging from roughly(105 to 103 mm) is…
Q: Describe the common signal transduction event that is perturbed by cancer-promoting mutations in the…
A: Neurofibromatosis type 1 (NF1) is a genetic disorder that runs in families. Peripheral…
Q: . What are heterogametes? What do we call these gametes individually?
A: Heterogametes are conjugating gametes that differ in their form, length, shape, or sexes, among…
Q: above are correct Except: All of the following are correct regarding the disk diffusion test photos…
A: Bacteria are microscopic, single-celled organisms that exist in every environment. They are present…
Q: describe the events that occur over the 6 day period following fertilization of an ovum
A: An ovum or egg is the female gamete of an individual. It can fertilize with the male gamete to form…
Q: Which of the following would not involve part of the appendicular skeleton? O taking this test O…
A: The skeletal system in humans is composed of 206 bones and a few cartilages. These are grouped into…
Q: Give 5 species of genus agrobacterium. Then make a clade. The clade must observe the rules of…
A: Agrobacterium arsenijevicii "Agrobacterium bohemicum Agrobacterium cavarae "Agrobacterium…
Q: TERMS: Amino Acid Cholesterol DNA Hydrolysis Hydrogen Sugar Carbon Nucleotide Nitrogen Carbohydrate…
A: Relation between terms and process given :-
Q: Active immunity is acquired over the course of a lifetime by exposure to antigens. Describe the two…
A: Immunity and immune system Immunity is the ability of the body to fight against consequences caused…
Q: in Asignacion x What is the xE Untitled do x 234610#question-179879-49 Q O * * a O Dasaoo eO…
A: Antibiotics treat bacterial infections. Fungi cause infections like athlete's foot, yeast…
Q: List the differences in the loading of the tRNA and its alignment with the mRNA between the…
A: Translation It is defined as the process of translating the sequence of mRNA molecules to the…
Q: Why are some fungi grouped under "fungi imperfecti"?
A: Deuteromycetes/Fungi imperfecti Some members are saprophytic or parasitic. A large number of…
Q: how the Americans with Disabilities Act and related standards for design have sought to improve…
A: Americans with Disabilities Act(ADA) Proposed in the year 1990, It provides equal rights to disabled…
Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 lb. 3/195 of the F2…
A: aabbccdd=5 lb AABBCCDD = 29 lb P: aabbccdd × AABBCCDD F1: AaBbCcDd
Q: Test Metabolic process indicated by a positive test. Citrate Indole Catalase Urease Methyl Red/…
A: Citrate test- are used to detect the use of citrate by an organism. Indole- it differentiates the…
Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 Ib. 3/195 of the F2…
A: The term "phenotype" refers to the observable physical properties of an organism; those consist of…
Q: Explain comprehensively how the ganglia originated embryologically? How do these affect the role…
A: The nervous system is the body's command room. Starting from the cerebrum, it controls developments,…
Q: Compare the structures and functions of the receptor molecules for salty and sour taste; the…
A: In our body, taste receptors are that kind of receptors who can senses the taste of food in oir…
Q: Explain comprehensively how the ganglia originated embryologically. How do these affect the role…
A: The sensory ganglia of the cranial nerves responsible for touch and gustation arise from two…
Q: In Mendel's genetic experiments many characteristics of the plants were quantified, such as their…
A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…
Q: Some species of algae, bacteria and shrimp can live in the Great Salt Lake in Utah. Such organisms…
A: A few bacteria, algae & brine shrimp species live in the great salt lake in Utah. They are…
Q: 4. Why do you think is the classification of organisms important? 5. Do you personally agree with…
A: Introduction Biological classification refers to the process of arrangements of living organisms…
Q: Q1: It is a group descending from one common ancestor A. Monophyletic B. Polyphyletic C.…
A: • Monophyletic : The taxon that includes organisms that descended from a single common ancestor is…
Q: Describe the organization of a motor unit in vertebrate skeletalmuscle, and explain how recruitment…
A: Skeletal muscles are attached to bones by tendons, and they produce All the movements of body parts…
Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 Ib. 3/195 of the F2…
A: Solution Lowest weight = 5 lb Highest weight = 29 lb Weight difference = 24 lb 3/768 = 1/256 Four…
Q: what steps will be appropriate if the cavity has only 0.5mm of remaining dentin before entering the…
A: Dentin is the part of the tooth that is beneath the enamel and cementum. It contains microscopic…
Q: 34. If all living things are able to improve their survival chances when exposed to new…
A: B is the correct option. This property is called, adaptation, where an organism adapt some changes…
Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…
A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…
Q: Which condition, aerobic or anaerobic, yields more energy (ATP) ?Why do you think this is ?
A: Respiration It is amphibolic and exergonic cellular process. Multistep enzymatic process. Metabolic…
Q: Suppose an environment in which vegetation respiration accounts for 10% of GPP and the energy in…
A: * Ecosystem ia a place where plants and animals and othe organisms interact together to form life. *…
Q: Explain the difference between aerial and basal tillers
A: Introduction : Tillers are branches develop from leaf axils of each unelongated node of shoot.…
Q: Discuss the importance of populations in natural means of the ecosystem
A: In ecology, a population consists of all the organisms of a particular species living in a given…
Q: Define about noncoding flanking genomic sequences ?
A: Genomic sequencing is the process of determining the entirety or nearly the entirety of the DNA…
Q: 4. The pre-mRNA encoded by the gene for calcitonin undergoes alternative processing to yield two…
A: Alternative splicing of precursor mRNA is an essential mechanism to increase the complexity of gene…
Q: Cardiology
A:
Q: Give example of 3 plant hybrid species and provide details on parental species, reason for…
A: Hybridization It has played an important role in the evolution of various lineages. With the…
Q: 1. The is the side of the epithelial cell that faces the external environment or an internal…
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: Describe the six steps in antigen processing and presentation via the class II MHC pathway.
A: MHC II uses the exogenous pathway for antigen processing and presentation for antigen presentation.…
Q: Supposed you have two individual peas. One of the peas is a pure breed with round green seeds while…
A: The Punnett square is a type of square diagram that is used to predict the genotypes of a particular…
Q: Question 11 Consider a locus with two alleles, A and a, in each of two random-mating populations of…
A: Here I will provide you information according to question i.e. what will be the allele frequency in…
Q: Because of the constant exchange of blood calcium and bone calcium, the concentration of calcium…
A: The calcium concentration in the blood is tightly regulated because of the importance of calcium for…
Q: What is the difference between REGULATORY VS SUBSTRATE DEPENDENT PATHWAYs. consider WT, single…
A: There are two types of paths available. Regulatory routes and assembly or metabolic processes have…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
