Concept Overview: Protein SynthesisTask 2: Review the process of protein synthesis by placing the cards in their appropriate category.Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledgecheck.TranscriptionTranslationNo Answers ChosenNo Answers ChosenTranscription & TranslationNeitherNo Answers ChosenNo Answers ChosenPossible answersDNA is copied into MRNAInvolves tRNA| Occurs in the mitochondriaInformation in MRNA is used to produce a proteinOccurs in the nucleusInvolves mRNAUtilizes ribosomesInvolves DNA polymeraseInvolves RNA polymeraseOccurs in the cytoplasm::::::::::::

The protein synthesis is the anabolic process of the synthesis of the protein by the polymerization…

Answered: Task 2: Review the process of protein…

Science

Biology

Task 2: Review the process of protein synthesis by placing the cards in their appropriate category.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: Which lab technique can you use to best answer these questions? How movable are membrane proteins?…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: How gene therapy treatment affect our future?

A: Gene therapy is the process of modifying genes in your body's cells to treat or prevent illness.…

Q: What are the applications of modern biotechnology in the field of engineering? b. What are the…

A: Introduction Biotechnology is the branch of science that deals with technology and biological…

Q: Download and read the attached review article…

A: Some cancer patients would only need one operation. Many patients, on the other hand, undergo a…

Q: Fluorescent Protein-Based Biosensors and Their Clinical Applications

A: Green fluorescent protein and its common proteins have shed light on many biological problems. The…

Q: Why is Research is now an integral activity in the organizations?

A: Research is a study which is detailed and careful in order to find out more information about the…

Q: B.Use the simple flow chart on the next page to outline the basic procedure of geneticengineeringin…

A: Genetic engineering is the process by which we make hybrid cell which is having better characters…

Q: could you make powerpoint presentation subtopics for Fluorescent Protein-Based Biosensors and Their…

A: In live-cell mechano transduction imaging and mechano pharmacological drug screening, biosensors…

Q: Complete the following tasks. You discovered that a species of bacteria can break down StyrofoamT…

A: Hi! Thank you for your question. As per the honor code, we are allowed to answer one question at a…

Q: Strategic intervention Materials for gene mutation for students to understand

A: Gene mutation: Gene mutation is the process in which a gene is formed and in the gene sequence a…

Q: Insights with the stem cell 10 sentences.

A: Introduction: Stem cells are found in the very early stage of embryo and these are undifferentiated…

Q: a. What are the applications of modern biological membranes in the field of engineering? b. What…

A: A bilayer of lipid molecules makes up the double sheet that makes up biological membranes. Generally…

Q: nges th

A: Pharmacist is the person who provides and delivers the medications to the patients after receiving…

Q: What orchestrates cell differentiation? Why is cell differentiation important? What does it lead to?…

A: Introduction :- Unspecialized cells become specialised through the process of differentiation to…

Q: Please help 33. Tissue engineering is the ability to grow cells in a laboratory. These cells are…

A: Introduction- Due to trauma or any other causes, body n=may lose the tissue and the human body's…

Q: Why it i

A: Functions like reimbursement, benchmarking, clinical and financial decision making, healthcare…

Q: (MRI device) 1. What are the ingredients? The device? 2. The working principle 3. What common…

A: Introduction Magnetic Resonance Imaging (MRI) is an imaging technique that uses radio waves and…

Q: uses of 1D and 2D polyacrylamide gel electrophoresis techniques

A: The technique of Gel electrophoresis is used or the separation of DNA fragments or macromolecules…

Q: nursing and molecular biology?asap

A: Relationship between Nursing and Molecular biology.

Q: Questions: 1. Write down the messenger RNA sequence when Gene F' is transcribed. 2. Write down the…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: Task 1: DNA Extraction To begin work on the bacterium, you begin by extracting its genomic DNA…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Show all working explaining detailly each step Solution should be typewritten with a computer…

A: The Rh factor means rhesus factor it's a protein found on the surface of RBCs known as Rh antigen.…

Q: Questions - Introduction 1. What kinds of materials obtained from a crime scene might contain DNA?…

A: As per the honour code, we are entitled to do only three questions at a time. Therefore I am…

Q: Answer True or False Ribosomes released from ER are immature and needs further processing

Q: Activity 1.4: Essay.Direction: Explain your answer.Today, it is easy to make transgenic plants and…

A: Transgenic plants or animals is a genetically modified organism (GMO) whose DNA has been altered…

Q: 1.Transcription factors (TFs) bind to promoter sequences on DNA because the shape of DNA at that…

A: Transcription is a part of central dogma, in which the DNA molecule is converted into mRNA by…

Q: Three [BIOMOLECULES] Instructions; — Answer the questions properly. — Do not copy in Google or…

A: Fatty acids are hydrocarbon chains with a carboxylic acid group. Fatty acids are classified as…

Q: Elaborate on DNA capabilities

A: DNA or deoxyribonucleic acid is a macromolecule composed of two polynucleotide chains that coil…

Q: Task 3: How can genetic engineering help in solving genetic problems like the thalassemia

A: Thalassemia is a genetic hematological disorder, which is characterized by reduced hemoglobin in the…

Q: Bio-sensor is a device consisting of immobilized layer of biological material such as_______.a)…

A: Science is a term which is used for the study of the subject which is based on the facts and…

Q: Go Green Before the Green Goes by Nano What does it mean? Please elaborate.

A: It is critical to protect the environment so as to reduce the destruction of eco-systems caused by…

Q: How important it is to develop your skills in micropipetting in the field of Molecular Biology?

A: Micropipetting is a essential skill in molecular biology. It needs to be mastered successfully so…

Q: a. What are the applications of modern biology in biological membranes? b. What are the…

A: Biological membrane or bio-membrane is a selectively permeable membrane that creates a barrier…

Q: How do you use FISH(fluorescence in situ hybridization) to detect gene rearrangement? Describe an…

A: FISH is a molecular cytogenetic technique that employs fluorescent probes that bind to just those…

Q: 1. What are the basic components of a Fluorescence Microscope and what are the functions of each?…

A: Note: Please note that as per our company honor code, citing external references are not allowed.…

Q: FITT

A: introduction Understanding the F.I.T.T. rule assists you with making an exercise plan that will be…

Q: . If you are a genetic engineer, what organism do you want to manipulate? And why?

A: As per Bartleby Guidelines We have only ONE question You may repost rest of the Questions : Answer…

Q: A 45 years old patient comes to you with chief complain of neck pain along with stiffness and the…

A: Car accidents can involve the damage of many important areas of the body, and it is fatal if the…

Q: a. What are the applications of modern biology in biochemistry? b. What are the implications of…

A: Modern biology is a culmination of physics, chemistry and engineering aspects. This helps us realize…

Q: Greetings and thank you for your help Using 2 examples, explain how biology can be studied from a…

A: Biology is the study of life and living organisms.

Q: (ultrasound device) Components of the method of work

A: The technologies which aids in defining, diagnosing, treating and improving the well being of the…

Q: Give the meaning of: in vivo & in vitro ; biopsy & autopsy

A: In vitro and invitro is a term used to specify the things happening in a living organism. Likewise,…

Q: Calculate the scan time for a GRE with TR = 30 msec, NEX = 2, Ny = 256, for (a) a single slice and…

A: The gradient-echo (GRE) pulse sequence is also known as gradient recalled echo. The main purpose…

Q: Choose one of the four macromolecules and discuss the relationship between its structure and its…

A: A macromolecule, such as a protein, is a very large molecule. They are made up of thousands of atoms…

Q: I need to approximate the width of the paramecium. But, I think my calculations are wrong. Please…

A: On images, there is given a scale bar so that the actual sizes of the objects in the provided image…

Q: Learning Task 2: In the space below, attach three to five examples of household items/goods(wrapper…

A: Biotechnology has an impact on health and medicine. Scientists have been able to produce novel…

Q: . In one or two paragraphs, explain the potential advantages and disadvantages of nanotechnology in…

A: Nanotechnology is branch of science which concern about research and innovation to make things…

Q: purpose of coding.

A: Medical coding consists of the explanation of the diseases, trauma, and healthcare techniques from…

Q: how does flow cytometry analyzer works and help in hematology

A: Flow cytometry is an analytical device used in cell culture and blood analyzing and it can observe…

Question

Concept Overview: Protein Synthesis
Task 2: Review the process of protein synthesis by placing the cards in their appropriate category.
Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledge
check.
Transcription
Translation
No Answers Chosen
No Answers Chosen
Transcription & Translation
Neither
No Answers Chosen
No Answers Chosen
Possible answers
DNA is copied into MRNA
Involves tRNA
| Occurs in the mitochondria
Information in MRNA is used to produce a protein
Occurs in the nucleus
Involves mRNA
Utilizes ribosomes
Involves DNA polymerase
Involves RNA polymerase
Occurs in the cytoplasm
::::
::::
::::

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Define both transcription and translation. In addition, describe the role(s) of each of the following in the processes of gene expression and protein synthesis: DNA, mRNA, tRNA, rRNA, ribosome(s), RNA polymerase, codon, anticodon, amino acid(s) and polypeptide(s). Be detailed in your answer.
The queation on my assignment is select the description of an exon? the answers they give are: 1. sequence of adenine nucleotides added onto the end of pre‑mRNA 2. modified form of a guanine nucleotide added onto the end of pre‑mRNA 3. coding portion of a DNA sequence that is present in mature mRNA 4. noncoding portion of a DNA sequence that is removed from pre‑mRNA then it wants you to explain your reasoning for your answer that you picked
PLEASE HELP! Please use the following terms and describe how each works to control protein expression. - Chromosomal level- Transcription- mRNA transcript- mRNA degradation- Translation blockage- Protein degradation
What are the functional consequences of this deletion for lilP mRNA transcription and translation? Motivate your answer (100 words max.)
INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Amino acyl tRNA synthase is the enzyme responsible for joining amino acid together STAMENT 2: Nucleus is the part of the cell where translation takes place ANSWER: STAMENT 1: DNA sequences where RNA polymerase binds initially is called promoter sequences STAMENT 2: UV light causes adenine to dimerize ANSWER: STAMENT 1: Guanosine is the name of the compound formed when guanine is bonded to ribose STAMENT 2: DNA pairing is the term that refers to the process when two complementary and single stranded DNA combine ANSWER:
Give typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’
B Relates to the ribosome codon question please do ii ribosome coding questions
Transcribe the following DNA sequence. Then translate the resulting mRNA transcript. GGACTACGTTCAAAAGCCATGGATTCGGTA Transcription: Translation: What would be the result of the following mutations in the DNA sequence above? How would the polypeptide change? How would you characterize this mutation? (Nucleotides are numbered from left to right.) a) nucleotide number 16 changes from a G to an A b) nucleotide number 12 changes from an A to a T c) nucleotide number 8 changes from a G to an A d) an insertion of a C between nucleotides 14 and 15.
Please answer asap and in short and content should not be palgarised please 1. what reaction activates the amino acids for attachment to the appropriate tRNA before being delivered to the ribosomes?
Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:
Explain, in detail, the process of DNA replication. Include in your answer, a diagram, the cellular location and reason for DNA replication, the names of all enzymes/molecules involved, and the sequence of events. a. Explain, in detail, the process of mRNA translation. Include in your answer, a diagram, the cellular location and reason for translation, the names of all enzymes/molecules/sites involved, and the sequence of events. Please help explain in fewer than 8 sentences!
Select whether each of the components are associated with eukaryotic or prokaryotic transcription. (When studying for exams, think about what the other component would be!) Prokaryote or Eukaryote?? RNA polymerase + sigma protein: TATA box: General/basal transcription factors: Rho-independent/dependent termination: [