Answered: The A-blood type allele and the B-blood…

The A-blood type allele and the B-blood type allele differ from each other based upon which of the following? chromosomal location DNA sequence phosphorylation of the protein mechanism of translation

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 4SQ

See similar textbooks

Related questions

Q: Which of the following is not involved in the process of translation? TRNA snRNA All are involved in…

A: Translation can be defined as the process by which RNA is used to make the proteins. The information…

Q: According to the central dogma, what molecule should go in the blank? DNA → _____ → Proteins…

A: DNA's full form is deoxyribonucleic acid. It is the genetic material of the organisms that transfer…

Q: Which of the following is considered to be a spontaneous source of mutations that impact the genome?…

A: Any Change in the genetic material, which is not caused by recombination, that leads to altered…

Q: The correct order of genetic information transfer within biological systems is BEST described as RNA…

A: The correct order is best described according to central dogma given by Francis Crick. According to…

Q: Gene expression includes which two of the following processes? O A. transcription and replication B.…

A: Gene expression:- This is a process where the gene’s genetic codes are used in managing the proteins…

Q: Gene ________ varies considerably within a genome,reflecting differences in intron size and in the…

A: A gene is a sequence of DNA nucleotides that encodes a protein. A genome of an organism includes all…

Q: Several different nucleic acids are involved in the process of getting a protein produced from a…

A: Sense strand is that strand of DNA double helix which has the translatable protein code in the 5'-3'…

Q: Which of the following is responsible for the ability of one gene to code for more than one type of…

A: During RNA Splicing: Introns -excised and exons - ligated together.

Q: In a nucleosome, the DNA is wrapped around ribosomes a thymine dimer polymerase molecules histones

A: Nucleosome Nucleosome is a segment of DNA that wrapped around a protein core.

Q: During transcription, an mRNA molecule is formed: True False inside the nucleus that is…

A: The central dogma of life is the biological information that flows from DNA to RNA and finally…

Q: The map of the chromosome which shows identifiable sites is called___________a) Gene expressionb)…

A: Chromosomes can be defined as thread-like structures where the DNA remains tightly packed within the…

Q: During transcription, an mRNA molecule is formed: *( Choose True if the statement is correct abourt…

A: Transcription: The process of making of mRNA from DNA carried out by an enzyme RNA polymerase.…

Q: What determines which base is to be added to an RNA strand during transcription? Base pairing…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: The "TATA box" is a [DNA, RNA, Carbohydrate, protein] sequence known as a [promoter, start codon,…

A: We all know that the central dogma of molecular biology explains that DNA codes for RNA, which codes…

Q: Which of the following processes occurs in the nucleus and forms acomplementary copy of one strand…

A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…

Q: Which of these pieces of a gene will ultimately be read by the ribosome to produce a protein?…

A: Pieces of genes introns and exons are actually nucleotide sequence within a gene. There is an…

Q: A single enzyme’s production is specified by a single Select one: a. histone b. gene c.…

A: One gene-one enzyme hypothesis states that the function of a gene is to dictate the production of a…

Q: Which of the following RNA molecules is responsible for carrying the code that will be read at the…

A: BASIC INFORMATION TRANSCRIPTION it is responsible for the formation of hnRNA which has the codes…

Q: in the process of transcription, _____. mRNA attaches to ribosomes RNA is synthesized…

A: Transcription is the cycle by which the information in a strand of DNA is duplicated into another…

Q: Which of the following units recognize UAG, UAA, and UGA codons? (Single answer) Elongation factors…

A: Genetic code is the combination of 3 nucleotide (called nucleotide triplet or codon) where each…

Q: During transcription, the DNA can be modified by the enzyme DNA methyltransferase and will enhance…

A: Transcription can be defined as the initial step of the protein synthesis in which RNA is formed…

Q: What kinds of DNA sequences are the "solution" the to C-Value Paradox? Transposable elements…

A: C-value indicates the amount of DNA present in the haploid cell or half of the DNA present in the…

Q: Which macromolecule encodes genetic information, can be replicated, and passed to offspring?…

A: Genetic information is the traits that are passed from the parents to their offspring. The traits…

Q: When the chromosomes are tightly condensed, the DNA is wrapped very tightly, making it difficult for…

Q: What is the smallest unit of heredity (genotype)?a. chromosome b. gene c. codon d. nucleotide

A: Chromosomes are the carrier of genetic material deoxyribonucleic acid (DNA). They are coiled in…

Q: The lagging strand of DNA is synthesized continuously in a 3' to 5' direction Discontinuously in a…

A: Introduction The process of producing two identical daughter DNA molecules from a single parent…

Q: A noncoding DNA sequence within a gene is called a(n) _____________.

A: BASIC INFORMATION DNA It stands for deoxyribo nucleic acid. It is the genetic material of all…

Q: What happens during the TERMINATION step of transcription? A. base pairs are added to the mRNA…

A: Transcription is a process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: What are the cellular activities that help describe "expression of genetic information"? (Choose all…

A: The procedure through which the information contained in a gene is often used to drive the…

Q: The ribosome recognizes and binds to the promoter region of DNA to initiate translation. true or…

A: To initiate translation a ribosome , an mRNA and an "initiator" tRNA carrying the first amino acid…

Q: The nucleotide at which transcription is initiated is called 1. -10 2. +1 3. -35 4. 0 5. -1

A: Transcription is the process by which gene are made to mrna sequence.

Q: CHANGE OF THE PROCESSES THAT CHANGE GENETIC INFORMATION INTO ITS NEW FORM

A: Genetics is one of the diverse and widely studied branch in the field of science. It is a branch of…

Q: What will be the sequence of the single-stranded RNA transcribed from the following segment of…

A: Answer: TRANSCRIPTION : It is the process in central dogma in which single stranded RNA is formed…

Q: When proteins are being built, RNA bases are read in sets of three. What are these sets called?…

A: Proteins are synthesized through the process called translation. The information stored in the DNA…

Q: Which of the following processes includes the removal of introns in the primary RNA transcripts? O…

A: Introns are noncoding sequences of an RNA transcript or the DNA encoding it. In simple terms,…

Q: Each one gives some basic information and summarizes its main role in translation. rRNA:…

A: The synthesis of protein or polypeptide chain from the mRNA sequence (that contain genetic codon) is…

Q: The following statements are true about human genes except: - They are found on circular…

A: The genes are the basic unit that is responsible for the development of a phenotype.

Q: Additional twisting of DNA upon itself is called ____________ The enzyme that can relax or remove…

A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…

Q: Which of the following histones bind to linker DNA?a) H1b) H2Ac) H2Bd) H3

A: Histones are a family of highly alkaline proteins present in nucleus of eukaryotic cell and they…

Q: The process of translation produces protein RNA sugar DNA none of these

A: Cells have many molecules present in the cytoplasm and organelles.

Q: "After MRNA is made, enzymes remove introns and splice together exons in a variety of ways. This…

A: Introduction In molecular biology, messenger ribonucleic acid (mRNA) is a single-stranded RNA…

Q: How can you get more than one protein from one gene? Alternative splicing/multiple mRNAs One…

A: According to the central dogma of molecular biology, the information stored in DNA is first…

Q: The structures within living cells that contain the genetic material is called A Chromosome…

A: Cell is an elemental unit of the body which is involved in various metabolic activities . It…

Q: A one base-pair change in a genetic sequence is called a mutation. revertible frameshift insertion…

A: Mutation: It is a change in the nucleic acid of an organism. It alters the nucleotide sequence of…

Q: If mutations occur in DNA, there are several mechanisms by which a cell can repair the defect. One…

A: The deoxyribonucleic acid (DNA) is the double-stranded molecule which is the genetic material in…

Q: egments of a DNA molecule that are transcribed, but do not contain the codes for amino acids in that…

A: A gene is the basic physical and functional unit of heredity. Genes are made up of DNA and each…

Q: Complete each of the following events in their proper order. In the first event you must transcribe…

A: Transcription is a process where DNA is converted to RNA in the nucleus of the cell while…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

The A-blood type allele and the B-blood type allele differ from each other based
upon which of the following?
chromosomal location
DNA sequence
phosphorylation of the protein
mechanism of translation

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

What is one possible DNA strand that would produce the following amino acid sequence? (Do NOT include any spaces) Histidine-Tryptophan-Lysine
Complete each of the following events in their proper order. In the first event you must transcribe the proper RNA sequence from the DNA sequence provided. In the next event, you must translate the RNA strand that you have just created and use it to create the proper string of AMINO ACIDS and, eventually, the proper PROTEIN. When your protein is completed, the final event is to match your protein with it's proper trait.
Which of the following is the definition of a gene? RNA that delivers amino acids to a ribosome during translation RNA that carries a protein-building message A unit of information encoded in the sequence of nucleotide bases in DNA The RNA component of ribosomes
When proteins are being built, RNA bases are read in sets of three. What are these sets called? Alleles Introns Exons Codons
According to the central dogma, what molecule should go in the blank? DNA → _____ → Proteins tRNA mRNA rRNA mtDNA
Which of the following DNA types forms the nucleolar organizer (nucleolus)? centromeric heterochromatin telomeres minisatellite rDNA clusters histone gene clusters
Which of the following is responsible for creating the covalent bonds that link the amino acids of a protein in the order specified by the gene that encodes that protein? rRNA tRNA mRNA ribosome
Which of the following, if any, cannot be genetically encoded in DNA? a)mRNA b)tRNA c)rRNA (RNA part of the ribosome) d)RNA parts of the spliceosome
Which of the following sequences is the best description of the complementary DNA sequence to the following sequence: 5'-CGATTAGC-3' Group of answer choices 5'-GCTAATCG-3' 5'-GCUAAUCG-3' 3'-CGATTAGC-5' 3'-GCUAAUCG-5' 3'-GCTAATCG-5'
An allele of a gene has the following change in its sequence, compared to the wild type. With reference to the sequence; there is a _____ mutation in the ______codon, resulting in a change from __________ to__________ which is a _______ mutation
Which of the following histones bind to linker DNA?a) H1b) H2Ac) H2Bd) H3
The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this gene code for? The top is the coding strand. 5' GGCTATGTATAGGGTAAACTTCTGACGCCTA 3' 3’ CCGATACATATCCCATTTGAAGACTGCGGAT 5’