The "TATA box" is a [DNA, RNA, Carbohydrate, protein] sequence known as a [promoter, start codon, n-terminus, 5' end] that signals areas where [translation, transcription, replication, protein sequencing] should begin.
Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…
A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…
Q: Translation always begins by adding a methionine to the beginning of every
A:
Q: In the process of translation, the input is and the output is O TRNA, MRNA O MRNA, protein O DNA,…
A: Translation is a process in which protein is synthesized from the information contained in a…
Q: Transcription factors usually contain one or more motifs that play key roles in their function. What…
A: A transcription factor is a sequence specific DNA-binding factor and upon binding to the DNA…
Q: A scientist, Dr. Doom would like to create a novel antibiotic by targeting translation in bacterial…
A: Transcription is a process of formation of transcript or RNA from DNA by the process of…
Q: Which of the following is not directly involved in translation?
A: Translation is the cycle where ribosomes present in the cytoplasm or endoplasmic reticulum blend…
Q: Which of the following types of mutations, resulting in a change in the mRNA just after the…
A: The translation process will result in the creation of proteins. The process of protein synthesis is…
Q: What is the name of the nucleotide sequence that helps the 30S ribosomal (small) subunit find the…
A: Translation initiation proceeds through the capture of mRNA by the 30s ribosomal subunit in…
Q: During translation, a peptide is PRODUCED , while the MRNA is READ N-->C, 3-->5' 5'-->3'; N-->C.…
A: ANSWER;- N'-- C; 5'--3';
Q: All of the following participate in the process of translation except: ribosomes mRNA tRNA 35S…
A: Translation It is defined as the process of production of proteins from the mRNA transcript. In…
Q: Which of the following is a true statement concerning codons A codon Will be read by RNA…
A:
Q: ) With the indication of sense strand, template strand, the direction of transcription, provide a…
A: the direction of the DNA template strand for transcription is Strand elongation DNA is…
Q: Which of the following are involved in transcription? O RNA polymerase DNA amino acids TRNA acetyl…
A: In translation mRNA, tRNA, rRNA, Amino acids, ribosome, acetyl transferase are required.
Q: Describe in detail the process of translation and transcription.
A: Introduction : In the field of molecular biology, the path by which DNA's information is encoded…
Q: After being irradiated, the gene coding for the E site is mutated, causing the E site to have a…
A: According to the central dogma of molecular biology, the information stored in the DNA is first…
Q: Which letter in the image represents the end product and the process of translation
A: Answer: CENTRAL DOGMA : It is the process of replication , transcription and translation of DNA.…
Q: The first amino acid in a purified bacterial protein is methionine. The start codon in the mRNA is…
A: The process of protein(amino acid) formation is called translation and it is the last step of the…
Q: In the diagram below (Figure 22), fill in the terms in the appropriate places indicated by a letter.…
A: This represents central dogma of molecular biology. It shows the flow of genetic information from…
Q: create a summary of the nucleotide pairs during the translation process
A: Answer: Introduction: Translation process occurs in ribosomes of cytosol or membrane of the…
Q: Which of the following codons is not a termination codon for protein synthesis?a) UUUb) UAGc) UAAd)…
A: UUU is not a termination codon for protein synthesis. Hence option a is the right answer UUU codes…
Q: Which sequences are spliced out of the mRNA strand before leaving the nucleus? In other words,…
A: Answer: TRANSCRIPTION : It is the process in central dogma where a DNA strand is transcribed in to…
Q: Which term describes each of these steps or substeps in the translation process? The ribosome shifts…
A:
Q: Which one of the following sequences is most likely to cause a ribosome to release a mRNA strand?…
A: A ribosome is an inter - cellular structure made up of both RNA and protein that provides as the…
Q: Define and identify the words listed below: CRISPR, codon, anti-codon, transcription
A: Definition: CRISPR: A segment of DNA compiled of short repetitions of base…
Q: Translation is a process which is best symbolized by a. RNA --> DNA b. DNA --> RNA c.…
A:
Q: Describe in detail all of the steps necessary to carry out translation. Amino acids, mRNA, 30S…
A: Translation is a complex process that requires many different molecules and steps. By understanding…
Q: What are the specific steps of eukaryotic translation? Be sure in your discussion that you include…
A: In transcription, a cell “copies” DNA sequence to a complementary RNA molecule. Then, in…
Q: Which of the following are stages of translation? Select all that apply. ---A tRNA binds to…
A: The translation is a process, in which tRNA (Transfer Ribonucleic acid), mRNA (messenger RNA),…
Q: All of the following are true about translation EXCEPT _____. as the ribosome moves from codon…
A: Answer :- All of the following are true about translation except - Ribosomal subunits and a…
Q: The ribosome recognizes and binds to the promoter region of DNA to initiate translation. true or…
A: To initiate translation a ribosome , an mRNA and an "initiator" tRNA carrying the first amino acid…
Q: During the initiation of translation, the ribosome assembles on an mRNA strand with the start codon…
A: The process of polymerisation of amino acids from a polypeptide is known as translation. The…
Q: The transcription enzyme that catalyzes a strand of RNA from a DNA template is called what?
A: A gene is an area of DNA molecule or polymer of amino acid that encodes function. A chromosome…
Q: In which of the following does nitrogenous base pairing (base complementarity via hydrogen bonds)…
A: Nitrogenous base pairing can include DNA-DNA, DNA-RNA, RNA-RNA pairing. Both DNA and RNA are made up…
Q: Which of the following steps in protein synthesis does not require a direct supply of energy? a.…
A: Protein synthesis inside the cytoplasm is known as translation. Translation process inside the cell…
Q: Using the following DNA template code, which of the following tRNA anticodons would carry the 4th…
A: Introduction DNA:- (Deoxyribonucleic acid) It is a long molecule that contains our unique genetic…
Q: Describe the critical role that complementary base-pairing plays in replication, transcription, and…
A: The nucleic acids have a property of complementary base-pairing. The nitrogenous base attached to…
Q: When translation begins, the first amino acid heads to the small subunit of the ribosome. What…
A: The translation is a process in molecular biology whereby the cell reads information from messenger…
Q: Which of the following sites would you predict to be present in the gene encoding a MRNA molecule…
A: mRNA known as messenger RNA carries the genetic information that is copied from DNA. mRNA contains…
Q: What amino acid sequence will be generated, based on the following MRNA codon sequence? 5' AUG- UCU-…
A: The genetic code is the precise sequence of DNA nucleotides interpreted as three-letter words or…
Q: If a DNA sequence , 3' TAC AAT GAA 5' , is the template for transcription, the resulting mRNA would…
A: CENTRAL DOGMA:- The whole process of Central Dogma involves two processes:- 1) When DNA changes into…
Q: Which process occurs with tRNA at the ribosomes? translation transcription…
A:
Q: The process of gene transcription begins with the joining of rRNA with various ribosomal proteins.…
A: The method of copying a part of DNA into RNA is referred to as transcription. DNA fragments…
Q: Elaborately discuss how does RNA synthesis affect translation process? How is tRNA involved in…
A: Protein synthesis is the process in which the proteins are made in form of peptide chains from the…
Q: The exon and intron sequences
A: The correct option is: 1. The exon and intron sequences
Q: If methionine is always the first amino acid incorporated into an oligopeptide, what oligopeptide is…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: Which of these statements is true about the elongation step of translation? The growing polypeptide…
A: Translation is the process of translating the sequence of a messenger RNA molecule to a sequence of…
Q: During transcription, the nitrogen base adenine on the DNA bonds with the nitrogen base…
A: Transcription is the process in which the information from a DNA strand is copied to a messenger RNA…
Q: DNA TAC - GGC - GAA - TCC - CCA - GTA - TCC - ATT ТСС - ТСС - АTT (gene) MRNA AUG Amino Acid Met…
A: DNA => Transcription => mRNA => Translation => Protein Transcription: Formation of RNA…
Q: What is the correct sequence in translation?
A: 1. Translation is the process of synthesis of protein from a transcribed mRNA. Translation…
The "TATA box" is a [DNA, RNA, Carbohydrate, protein] sequence known as a [promoter, start codon, n-terminus, 5' end] that signals areas where [translation, transcription, replication, protein sequencing] should begin.
Step by step
Solved in 2 steps
- If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA transcription and translation what would be the amino acid sequence of the product?Which of the following statements about the translation process is correct? a. RNA is made complimentary to DNA b. A protein is made from the DNA base sequence c. DNA is made complimentary to RNA d. A protein is made from the RNA base sequenceTranslation is a process which is best symbolized by a. RNA --> DNA b. DNA --> RNA c. DNA --> protein d. RNA --> protein e. Protein --> RNA
- The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus)The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using ONE-letter amino acid code starting from N-terminus to C-terminus)Describe the critical role that complementary base-pairing plays in replication, transcription, and translation.
- Match the following with the correct nucleic acid. (mRNA, tRNA, rRNA, or All RNA) 1. This molecule is complementary to DNA. 2. This molecule is part of translation. 3. This molecule is part of the ribosome. 4. This molecule contains anticodons. 5. This molecule is esponsible for bringing amino acids to the ribosome. 6. DNA is used as a template to create this type of RNA molecule. 7. This molecule is part of transcription. 8. This molecule contains codons.After being irradiated, the gene coding for the E site is mutated, causing the E site to have a greater attraction for tRNA. Which process will be most directly affected by this mutation? DNA replication, Transcription, or TranslationWhat are the specific steps of eukaryotic translation? Be sure in your discussion that you include the following terms: start codon, initiation, elongation, termination, tRNA, rRNA, A site, P site, E site, translocation; stop codon.
- The following base sequence is a complete polynucleotide made in a bacterial cell. AUG, GCC, AUG, GUU, AAA, CCC, GGA, GGG, UGA How many codons will be transcribed in the mRNA made from the template DNA strand and the tRNA anticodons that correspond with this sequence.Define and identify the words listed below: CRISPR, codon, anti-codon, transcriptionWhich of the following are stages of translation? Select all that apply. ---A tRNA binds to the second codon and its carried amino acid forms a peptide bond with methionine. ---When the ribosome reaches a stop codon, its subunits detach, and the mRNA and new polypeptide are released. ---As the ribosome moves from codon to codon, amino acids brought by successive tRNAs to the ribosome form a growing polypeptide. ---The binding of a tRNA to the third codon causes the ribosome to release the first tRNA and move to the next codon. ---Ribosomal subunits and a tRNA carrying methionine converge on the start codon of an mRNA.