The addition of new nucleotides to a growing polynucleotide strand occurs in a ___. a) 53 direction on the lagging strand, and 35 direction on the leading strand b) 5 3 direction c) amino-carboxy direction d) 53 direction on the leading strand, and 3-5 direction on the lagging strand e) 3-5 direction Question 100 (Mandatory) Micro RNA, siRNA, anti-sense RNA are all able to prevent the use of a processed mRNA. What level gene regulation event is this? a) chromatin b) transcription c) post-translation d) translation

The addition of new nucleotides to a growing polynucleotide strand occurs in a ___. a) 53 direction on the lagging strand, and 35 direction on the leading strand b) 5 3 direction c) amino-carboxy direction d) 53 direction on the leading strand, and 3-5 direction on the lagging strand e) 3-5 direction Question 100 (Mandatory) Micro RNA, siRNA, anti-sense RNA are all able to prevent the use of a processed mRNA. What level gene regulation event is this? a) chromatin b) transcription c) post-translation d) translation

Name: 8:21A■■ LTE< Spring 2024 - Senior Comprehensives (...Question 77 \IVI
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 8:21A■■ LTE< Spring 2024 - Senior Comprehensives (...Question 77 \IVIDITUDɩory)The addition of new nucleotides to a growingpolynucleotide strand occurs in a ___.a)53 direction on the lagging strand, and35 direction on the leading strandb) 5 3 direct

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 31CTQ: If the rate of replication in a particular prokaryote is 900 nucleotides per second, how long would...

See similar textbooks

Similar questions

EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1
13- Which of the following substitutions do not produce hidden mutations, that can not be observed when two DNA sequences are aligned and compared for substitution? a) b) () d) e) convergent substitution coincidental substitution parallel substitution single substitution back substitution
DNA GAAGGGACAATACTTTCTTAACACTTG MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis? Conclusion Questions: 1. Examine the protein you created. If the DNA strand that you started with had a change in it (A changed to G), what would happen to the protein made?
31_30*_SP23 - General Biology I (for m 24 ed out of nove flag evious page A $ Transcribe the following DNA: TACGGGGCTGAGATT Select one: O a. UACGGGGCUGAGAUU O b. Tyr-Gly-Ala-Glu-lle C. Met-Pro-Arg-Leu-STOP O d. AUGCCCCGACUCUAA MacBook Air
1_30*_SP23 - General Biology I (for majors)/1 of us page The anticodon sequence created from the following DNA: TACGGGGCTGAGATT F1 Select one: O a. Tyr-Gly-Ala-Glu-lle O b. AUGCCCCGACUCUAA c. UACGGGGCUGAGAUU O d. Met-Pro-Arg-Leu-STOP F2 # 80 F3 $ 000 000 F4 % F5 MacBook Air F6 & r F7 DII F8
B. Answer the following questions briefly. 1. How do we know that complementary base pairs in DNA really exist? 2. Compare and contrast replication, transcription and translation based on template used, direction of synthesis, protein/enzyme requirements during initiation, elongation and termination and products. CRITERIA of Replication Transcription Translation comparison 1. Template used 2. direction of synthesis 3. protein enzyme requirements a. Initiation b. Elongation c. Termination 4. Products 3. How do we know that expression of the information encoded in DNA involves an RNA intermediate?
Third letter UCAG UCAGH CAC First letter Part 5: Coding Practice 1. Use this sequence of DNA to answer the following former test questions: 5'-- TTAATGGGACAGCTTGTGTAGAGG --3' a. What is the complementary strand of DNA? b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence? C. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)? Remember: i. Start codon! ii. Stop codon! bac ocent Seond letter UUU Phe UAU Tyr UGU UGC Cys UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G C. UUA UCA UUG Le UCG [ CAU ] CAC CUU CGU His CUC C CGC ne. CCA Arg Pro CUA CAA CGA CCG CAG Gin CGG CUG AAU 1 AAC Asn ACU AGU [ [ AUU AUC Ile AGC Ser Thr A AUA AGA AGG ACA AAA Arg AUG Met ACG AAG GUU GCU GAU GGU Asp GAC GCC GGC GUC Val G GUA GCA Ala GAA GGA Gly GAG Glu GGG GUG GCG
How many letters of an RNA molecule, in sequence, does it take to provide the code for a single amino acid? 1 2 3 4
-66 The following sequence of the DNA template strand contains: 5'AGGCTCCAGG 3' out of Which complementary RNA strand can be made from this sequence? uestion Select one: O a. 5' UCACAGGUCU 3" O b. 5' UCCGAGGUCU 3" O c.5' CCUGGAGCCU 3' O d. 5' UGGCTCCUGC 3' e. 5' GACCTCGGAA 3"
7:07 1 How Mutations Occur (Developing) Question O Practice It! /// A Select the statement(s) that accurately describe the function of DNA polymerase and the types of mutations that may occur. O Point mutations occur when a single nitrogenous base is substituted. Frameshift mutations occur when a nitrogenous base is inserted or deleted. start d le O Point mutations are less serious than frameshift mutations, as only a single base pair is affected. DNA has rare mutations during replication because DNA polymerase functions to build and repair errors in nitrogen base pairings of A-G and T-C. 3 Pro O DNA has rare mutations during replication because DNA polymerase functions to build and repair errors in nitrogen base pairings of A-T and G-C. O Point mutations occur when a nitrogenous base is inserted or deleted. Frameshift mutations occur when a single nitrogenous based is substituted. B.McKenzie - Uncontrolled Cell Growth B.McKenzie - Uncontrolled Cell Growth B.McKenzie - Uncontrolled…
1) What DNA base sequence is complementary to the following DNA sequence?TAGCGTGCATGGTGCTTAAC2) What RNA base sequence is complementary to the following RNA sequence?UAAUAGCUUGCUGAU