The baby pushes against the cervix, causing it to stretch. normal Uterus 19. The image to the right is an example of: a. a negative feedback loop b. a positive feedback loop Stretching of the cervix causes nerve impulses to be sent to the brain. Oxytocin causes the uterus to contract 20. If the calcium in your blood decreases below the set point, a gland in the brain will sense the decrease and send a chemical message to your bones. Your bones will release calcium into the blood, bringing blood calcium levels back up. This is: a. a negative feedback loop b. a positive feedback loop Umbilical cord Cervix The brain stimulates the pituitary to release axytocin.

Question
The baby pushes
against the cervix,
causing it to stretch.
normal
Uterus
19. The image to the right is an example of:
a. a negative feedback loop
b. a positive feedback loop
Stretching of the
cervix causes
nerve impulses
to be sent to
the brain.
Oxytocin causes
the uterus to
contract
20. If the calcium in your blood decreases below the set point, a gland in
the brain will sense the decrease and send a chemical message to
your bones. Your bones will release calcium into the blood, bringing
blood calcium levels back up. This is:
a. a negative feedback loop
b. a positive feedback loop
Umbilical
cord
Cervix
The brain stimulates
the pituitary to release
axytocin.
Expand
Transcribed Image Text

The baby pushes against the cervix, causing it to stretch. normal Uterus 19. The image to the right is an example of: a. a negative feedback loop b. a positive feedback loop Stretching of the cervix causes nerve impulses to be sent to the brain. Oxytocin causes the uterus to contract 20. If the calcium in your blood decreases below the set point, a gland in the brain will sense the decrease and send a chemical message to your bones. Your bones will release calcium into the blood, bringing blood calcium levels back up. This is: a. a negative feedback loop b. a positive feedback loop Umbilical cord Cervix The brain stimulates the pituitary to release axytocin.

Expert Answer

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Other

Related Biology Q&A

Find answers to questions asked by students like you.

Q: How hormones can be grouped on the basis of their chemical composition?  (Explain)

A: Click to see the answer

Q: 3) You have identified an interesting mutant in gene P. Using a Punnett square, demonstrate the cros...

A: Genes are the functional unit of heredity. Genes are made up of DNA and they carry coded genetic inf...

Q: (Physiology)  Nurse Emma measured out 5 grams of potassium chloride (KCL). Using dimensional analysi...

A: In chemistry, mole is the unit to tell the amount of a substance. A mole is defined as the substance...

Q: Difference between male and female pine

A: Pine trees undergo sexual reproduction by producing seeds. Pine seeds are present on scales. These s...

Q: 6) There is clear evidence that chromatin state is directly related to the ability of proteins to in...

A: The chromosomes appear as a mass of greatly fine tangled string called "chromatin." Chromatin is enc...

Q: Which reaction does the enzyme carbonic anhydrase catalyze?

A: The enzyme carbonic anhydrase balances the blood’s pH and helps in the expiration of carbon dioxide ...

Q: Can the carbons in ketones be metabolized and wind up in a glucose monosaccharide?  If yes, using me...

A: Ketone bodies are produced in the body during fasting conditions, consumption of carbohydrate lackin...

Q: What are mutations and their impact on a DNA sequence?

A: Mutation is an alteration in gene sequence of the DNA. The nucleotide on the DNA sequence is altered...

Q: Briefly describe the unifying themes that characterize the biological sciences

A:  Unifying themes refers to the concepts of biological sciences that connect the different areas of b...

Q: What is the most common element in the human body?

A: There are various elements that form the human body. The elements are important to regulate the cell...

Q: Cortisol - For the hormone Cortisol (in humans) what is; 1. the origin (gland that secretes the horm...

A: Hormones are chemical messengers or signaling molecules that are produced by the ductless glands and...

Q: 10. True or False? The prevalence of a disease depends on the incidence of the disease as well as th...

A: The given statement is true.The prevalence of a disease is the section or amount of population that ...

Q: What is the function of Estrogen?

A: Hormones are chemical substances that help to control and maintain body growth and activity. Testost...

Q: Explain how ATP is produced using the terms proton-motive force, concentration gradient, ATP synthas...

A: Adenosine triphosphate (ATP) is a complex energy rich organic molecule that serves as a source of en...

Q: What is a glycosidic bond?

A: Glycosidic bond refers to the covalent bond that links a sugar or carbohydrate molecule to the secon...

Q: Explain how osteoblast and osteoclast regulate bone mass, make sure to involve the hormones.

A: The regulation of bone mass is called bone remodeling, in which mature bone cells are removed from t...

Q: list the functions of the plasma membrane, cytoplasm, and nucleus

A: Functions of the plasma membrane:Plasma membrane also called a cell membrane protects the cell from ...

Q: If mRNA can be blocked, what would the consequences be? what applications could this be useful when ...

A: Three types of RNA interact to synthesize proteins namely, mRNA, tRNA, and rRNA. Among these, mRNA c...

Q: 17) There is a hypothetical gene in mice that produces a substance that induces twitchiness in hind ...

A: Here, it is given that female mouse of a true-breeding twitchy strain is mated with a male of a true...

Q: Restless leg Syndrome is ? 1. Linked to genetics: Researchers do not know the cause of restless legs...

A: A neurological disorder is any disorder of the nervous system. A sleep disorder is a medical disorde...

Q: What is the main function of the endocrine system?

A: The endocrine system is the collection of different type of glands. These glands produce and secrete...

Q: Please help me

A: Click to see the answer

Q: 10) Scientists have engineered a simplified CRISPR-cas system for use in mammalian cells. What were ...

A: Genome editing:It is also known as gene editing or genome engineering. It is a type of genetic engin...

Q: 1.) Give one example of a cis-acting regulatory element.

A: Cis-regulatory elements (CRE) include non-coding regions of DNA that regulate the transcription of t...

Q: The idea that the study of the human body can be most thoroughly understood through the principles o...

A: The study of the structures of the parts of the body is termed as the anatomy, while the study of fu...

Q: 13) What is the purpose of the negative selectable marker in a mouse knock out cassette?  a) Why don...

A: The negative selection marker used for the creation of knock-out mouse is thymidine kinase gene deri...

Q: How does tail docking affective the stress level and overall behavior in horses? or is there no chan...

A: During docking process, horses experience an acute pain due to which they show some changes in handl...

Q: The Gardasil 9 vaccine prevents infection by all types of human papillomaviruses. True or False

A: The given statement is false.Human papillomaviruses (HPV) cause sexually transmitted diseases that c...

Q: If the frequency of a homozygous recessive disorder is 1 in 10,000, the frequency of the dominant al...

A: The frequency of homozygous recessive disorder refers to the frequency of the homozygous recessive g...

Q: Which of the following is not true regarding Bryophytes? Lack roots, stems and leaves Include mosses...

A: The correct answer is option (c) sporophyte is the dominant generation.In bryophytes, the dominant s...

Q: Give an example of a gene that encodes information for some final product which is not a peptide

A: Genes are the short segments of nucleotides present in the DNA. The region where a gene is present o...

Q: 9) Describe the steps required to use sequencing DNA to identify your gene of interest after perform...

A: Forward genetics screen is method used to identify the genes controlling a phenotype in the organism...

Q: Can you please label the skull

A: A skull is a bony structure that is composed of cranium and facial bones. The composition and the sh...

Q: Explain the importance of regulatory mechanisms in living things.  Distinguish between positive and ...

A: The regulatory mechanism is very important to maintain the equilibrium in every living organism.  Th...

Q: 8. True or False? Relative risk is an ideal form of measurement for a retrospective cohort study des...

A: The answer is true.The retrospective cohort study design involves the observation of archived data t...

Q: How are there thousands of types of different organic molecules found in cells, but just four differ...

A: Click to see the answer

Q: Which breeds of dogs are tail docking done to? and why are they done in those breeds

A: Tail docking is a procedure of removing a portion of tail in dogs.  Docking is done by surgical remo...

Q: Mechanistically, how does NADPH facilitate the removal of an oxygen atom from intermediates in fatty...

A: Fatty acid synthesis is the production of fatty acids from acetyl-CoA and NADPH through the action o...

Q: 1. There are two metabolic routes for the conversion of oxaloacetate to phosphoenolpyruvate (PEP). W...

A: Hello. Since you have posted multiple questions and not specified which question needs to be solved,...

Q: Why must starch be hydrolyzed before it can be used as an energy source or transported?

A: Carbohydrates are the sugars that include monosaccharides (simple sugars) and polysaccharides. Starc...

Q: 3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T ACGC...

A: Since we are entitled to answer first question, we’ll answer the question 3 as you have not mentione...

Q: Describe the movements of chromosomes and the status of microtubule spindle during interphase, proph...

A: Interphase – During interphase, the chromatin gets decondensed inside the nucleus, due to which chro...

Q: Here is the question: What was the likely source of the raw material incorporated into the first lif...

A: Click to see the answer

Q: During electron transfer through the mitochondrial respiratory chain, the overall reaction is NADH +...

A: “The electron transport chain” is found in the inner mitochondrial membrane in eukaryotes. The elect...

Q: You are working in a biotechnology lab arid are analysing DNA. You obtain a sample of a short dodeca...

A: In a double-stranded DNA (deoxyribonucleic acid) molecule, the nitrogenous base pyrimidine hydrogen ...

Q: how does aldosterone affect water and sodium reabsorption and secretion of potassium in the collecti...

A: Aldosterone is a steroid hormone that is produced in the cortex region of the adrenal gland. Its mai...

Q: A phylogenetic tree represents...  a hypothesis about evolutionary relationships a branch point for...

A: A phylogenetic tree is the branching tree like diagrammatic representation of the relationships amon...

Q: What is the difference between heterochromatin and euchromatin? What accounts for (or causes) the di...

A: The chromosomes appear as a mass of greatly fine tangled string called "chromatin." Chromatin is sur...

Q: Describe the difference between Gram(-) and Gram (+) bacteria. Specifically focus on the differences...

A: Gram staining refers to the staining technique that classifies bacteria in the two broad categories ...

Q: what is medullary papilla?

A: The organ system in a body that functions to excrete the waste out of the body is termed as the excr...