the following processes except a.         alternative splicing to produce a secreted form of the T-cell receptor b.         isotype switching c.         somatic hypermutation d.         somatic recombination Activated T cells express _____, which binds to B7 with 20 times higher affinity than CD28 and results in _____ of T-cell activity and proliferation. a.         high-affinity IL-2 receptor; stimulation b.         CD40L; suppression c.         CTLA-4; stimulation

Q: Question 8 What causes eyeshine in some animals like cats? O a reflective layer at the back of the e...

A: 8. ANSWER;- A reflective layer at the back of the eye that allows light to bounce around more, enhan...

Q: Which structure is highlighted? Multiple Choice saphenous nerve obturator nerve sciatic nerve and br...

A: Introduction Saphenous nerve:- it is the largest branch of the femoral nerve and innervates the medi...

Q: A 60-year-old woman with history of lung cancer is admitted for weakness and lethargy for 4 weeks. H...

A: Answer C --118mEq/L

Q: You are Jeremy’s Biology professor, and he ask you about taking steps to “bulk up”. What would your ...

A: Being a doctor and taking this question as in general category. One should do the followings things ...

Q: Auditory neural signals are sent when HAIR CELLS in our inner ears open ion channels along their pla...

A: The fluid that surrounds the hair cells, known as endolymph, is high in potassium. When the hair cel...

Q: What are the differences of yeast from other kingdom?

A: Yeast is a single-celled creature known as Saccharomyces cerevisiae that requires food, warmth, and ...

Q: vestigial part. Explain the reason why that part of a body is considered a vestigial one structure.

A: A vestigeal part in humans is an organ, tissues or cells that are no longer functional the way they ...

Q: Can you tell me about a scientist that has advanced humanity's knowledge about malaria, please?

A: Malaria is a serious and sometimes fatal disease, it is a disease caused by a plasmodium parasite, t...

Q: Cleavage Ligand Precursor Receptor Inactive Receptor Active www 99 Cell Membrane 6. The figure above...

A: In case of hydrophilic signalling molecules (ligand), they binds with specific transmembrane recepto...

Q: How do normal cells get transformed into cancerous neoplastic cells? Elaborate giving three examples...

A: In normal cells the processes like cell division and differentiation are highly controlled and coord...

Q: Coat color of dogs depend upon the action of at least two genes. At one locus a dominant epistatic i...

A: There are some important points: We know that genes are functioning independently on each other and ...

Q: 1. How are you going to perform compatibility testing/crossmatching in the following special cases? ...

A: Introduction:-  Blood compatibility test is used in laboratories to determine if a particular unit o...

Q: close relative of this flower has very large sepals compared to this one.  Apply what you know about...

A:   Introduction  For the specification of four whorls of floral organ,  three classes i.e A,  B,  C, ...

Q: Discuss and explain deamination and repair

A: Repair of deamination product is done by base exision repair. Enzymes like DNA glycosylase, AP Indon...

Q: cancer theoretical framework   1 Definition of concepts 2 Specification of the hypothesis to be i...

A: The theoretical framework of cancer is the structure that can hold or support a theory of cancer res...

Q: What electron-transport components participate in the Q cycle in mitochondria, in purple bacteria, a...

A: The electron transport chain is also called the Cytochrome oxidase system or as the Respiratory chai...

Q: This molecule: •contains potential energy •is used to convert CO2 into glucose •has an unstable trip...

A: The molecule is ATP and it has unstable triphosphate tail , the main energy sources comes from hydro...

Q: Which of the following is an example of allosteric regulation? A. the binding of CAMP-CAP to DNA B. ...

A: Allosteric regulation is a form of regulation where enzymes or molecules are regulated by binding to...

Q: 1. Reports about a man who successfully undergone xenotransplantation of a pig heart in replacement ...

A: Introduction :- Transplantation is method or process by which the cells , tissues , organs are trans...

Q: Which of the following processes involve random (chance) events?

A: The answer is all of the above. All the events as given,Genetic drift,Genetic recombination by cross...

Q: Describe the mode of action beta-lactam, aminoglycosides, polyenes, and quinolone antimicrobial agen...

A: Antimicrobial agents are defined as a substance that either kills or inhibits the growth of microorg...

Q: Put the trophic levels in order such that (a) likely has the lowest concentration of mercury. apex p...

A: Introduction :- In natural environment , organisms are categorised into different trophic levels acc...

Q: Identify

A: The organism which causes the above shown infection is Candida albicans.  

Q: How does pH influence the growth of microbes? Why do microbes grow best at a particular pH and not a...

A: pH influences the occurrence and distribution of microorganisms, Microorganisms grow best at their o...

Q: What are the prevention methods against tuberculosis today?

A: The bacterial disease responsible for affecting the lungs can be described as tuberculosis. This dis...

Q: Coral reefs are being threatened and/or damaged by all of the following, except discharge of industr...

A: A coral reef is an underwater surrounding characterized by using reef-constructing corals. Coral ree...

Q: a) The energy-carrying molecule ATP is made by the enzyme ATP synthase. Muscle cells use a lot of en...

A: * ATP is formed by ATP synthase in mitochondria membrane. * The net molecules of NADH and FADH and G...

Q: Discuss the significance of chromosomes in terms of their information content.

A: Introduction  The chromatin fibre is present as in the most uncondensed form packaged in the nucleus...

Q: 28. During respiration, most ATP is formed as a direct result of the net movement of (A) potassium a...

A: Synthesis of ATP occurs through aerobic cylinder respiration in the mitochondria. The enzyme ATP syn...

Q: Gather data about the mammals, an organism from the animal kingdom, from its classification system, ...

A: Mammals are derived from the Latin word "mamma" which means breast. Mammals are a huge group of anim...

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA transcrip...

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate...

Q: What is a selective sweep? O When a beneficial mutation is lost due to genetic drift. O When a benef...

A: Certain terms are fundamental concepts in biology, the study of living organisms. Theses terms are s...

Q: Roy was a ruthless, manipulative, self-centered person who stole from anyone and felt no remorse. Ev...

A: Narcissistic:-  It is a mental condition in which people have an inflated sense of their own importa...

Q: -2 -5 -6 21 L7 .8 9. -10 22- 17- 18 -11 3.

A: Answer labeling lung diaphragm

Q: Nitric oxide (NO) is a gaseous molecule with lipid solubility similar to that of O2 and CO2. Endothe...

A: ANSWER: Nitric oxide (NO) is a gaseous molecule involved in several physiological and pathological ...

Q: 2. How should the following patients be identified? a. siblings or twins b. newborns C. common names...

A: Identification is essential in both civil and criminal cases in living persons (cases like divorce, ...

Q: What cells have a plasma membrane

A:    INTRODUCTION        In the fundamental molecules of life system , Cell is the primary membrane bo...

Q: Chimpanzees, bonobos, and orangutans cannot speak like us because A: They are too stupid. B: Their a...

A: Speech is a communication that is used to express our thoughts in words. 

Q: Q1 A population with a heterozygosity value of 0.5 necessarily satisfies the Hardy- Weinberg equilib...

A: Hardy-Weinberg Equilibrium is a concept that serves as a benchmark for researchers to analyze gene e...

Q: Predict or describe the absorbance or enzyme activity at:       pH = 2   pH = 14 Explain your predi...

A: The single most crucial asset of enzymes is the ability to increase the rates of reactions going on ...

Q: Sketch a mitotic prophase chromosome and label sister chromatids, sister centromeres, and sister kin...

A: Prophase is the first phase of mitosis. Three major steps happens in this phase-   Condensation of c...

Q: To ensure easier focusing, what should be done first before the HPO is swung into position?

A: High power objective lens is used to examine fine details of the given specimen. The total magnifica...

Q: Name the main benefit that vascular tissue provides to land plants. Explain how vascular tissue bene...

A: In land plants, vascular tissues can be observed. These tissues include xylem and phloem. The compon...

Q: Binomial Nomenclature a) a kingdom proposed by Ernest Haeckel b) linnaeus c) a category with 1 or...

A: * Binomial nomenclature  also called taxonomy binomial nomenclature or binary nomenclature. *system ...

Q: Certain proton pump inhibitors that inhibit secretion of stomach acid are among the most widely sold...

A: H2 blockers or histamine H2-receptor antagonists are drugs that minimize the acid production in the ...

Q: similarities and differences between malaria and covid 19

A: An infection is the invasion of an organism's body tissues by disease-causing agents, their multipli...

Q: Define the terms phenotype, genotype, locus, allele, dominant allele, recessive allele, homozygous, ...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Gen...

Q: 9. Two nutrient solutions are maintained at the same pH. Actively respiring mitochondria are isolate...

A: The cellular respiration is responsible for the breakdown of glucose and production of energy in the...

Q: Differentiate vasculogenesis from angiogenesis

A: Vasculogenesis- vasculogenesis is the de Novo synthesis of blood vessel. It leads to the development...

Q: Match the terms with the most suitable description. ___ operon                     a. makes a man ou...

A: The options are matched with the suitable description and they are given below