Q: Let’s suppose you have recently identified an organism that wasscraped from an asteroid that hit the…
A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…
Q: Indicate whether each of the following statements about the double-helix secondary structure of DNA…
A: Deoxyribonucleic acid (DNA) is the double stranded and complex molecule. It consists of crucial…
Q: A key difference between the nucleotides found in DNA andthose in RNA is thata. DNA has phosphate,…
A: Deoxy ribonucleic acid (DNA) is he genetioc material of most organisms, while ribonucleic acid (RNA)…
Q: If one strand of DNA has a sequence of TCAG, then the sequence of bases on the complementary strand…
A: DNA is double stranded where the two strands are antiparallel and follows complementary base…
Q: DNA exists in cells as a double-stranded duplex molecule, whereas RNA, which is composed of very…
A: DNA and RNA are found in diverse forms and structures to facilitate particular functions. These…
Q: The two complementary strands of the DNA double helix are held to each other by (a) ionic bonds…
A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…
Q: Helicase unwinds DNA by disrupting... A. Covalent bonds B. Hydrogen bonds C. A and B D.…
A: DNA stands for deoxyribonucleic acid. It is the genetic material present in most of the eukaryotes.…
Q: A key difference between B DNA and Z DNA is thata. B DNA is right-handed, whereas Z DNA is…
A: DNA is the molecule which carries the genetic information of the cell. It is a long biopolymer of…
Q: b) Draw a diagram to show how nucleotides are organised in the structure of DNA. Note: You need only…
A: The four most important biomolecules in living things are carbohydrates, amino acids, lipids, and…
Q: DNA strands are complementary to each other. If one strand has the nucleotide sequence ATTGGCCTT,…
A: DNA is composed of a backbone consisting of ribose sugar & phosphate, and nitrogen bases.…
Q: You have a sample of genetic material. The nitrogenous base content is 29% guanine. a) If the…
A:
Q: Very carefully analyze each nucleotide structures (base and sugars) and identify the structure(s)…
A: Deoxyribonucleic acid or DNA is a type of nucleic acid present in the nucleus of the cell. It is a…
Q: Draw the structure of each nucleotide: (a) UMP; (b) dTMP; (c) AMP.
A: Introduction: Nucleotides are chemical compounds that are made up of nucleoside and phosphate. They…
Q: A groove in a DNA double helix refers toa. the indentations where the bases are in contact with the…
A: The DNA is the genetic material which is made of nucleotides. The structure of the DNA is double-…
Q: The “rungs” of the DNA double helix are held together by a. ionic bonds.b. hydrogen bonds.c.…
A: Introduction: DNA, also known as deoxyribose nucleic acid is made up of nucleotides which comprises…
Q: The antiparallel nature of DNA refers to a. its charged phosphate groups. b. the pairing of bases on…
A: DNA is the genetic material in most eukaryotes and few prokaryotes. It is a linear polymer of…
Q: Which of the following are shared properties of DNA and RNA three-dimensional structure formation?…
A: Ribonucleic acid (RNA for short) is a nucleic acid present in all living cells that has a structural…
Q: Many diseases, cancers and even normal human variations can be caused by mutations and variations in…
A: Mutations creates a genetic variation and genetic diversity. Not all mutations are harmful, some are…
Q: The amount of G plus C in an organism’s DNA is 64% of the total base content of that DNA. What are…
A: DNA (deoxyribonucleic acid) is that the genetic material present in archaea, eubacteria,…
Q: Why is the particular sequence of bases in a segment of DNA important to cells? A. Some base…
A: The DNA and RNA are the two major bunches of nucleic acids. Nucleotides, have following which are…
Q: Each phosphodiester linkage in DNA or RNA includes a phosphate joined by covalent bonds to (a) two…
A: The gene is the primary unit of heredity of all life forms. Most organisms contain deoxyribonucleic…
Q: In a double-stranded DNA molecule, how are the sequences of each strand related to each other? The…
A: Deoxyribonucleic acid, also abbreviated as DNA, it is the principal informational macromolecule of…
Q: Segments of DNA act as templates that guide the amino acids to join together to form a. proteins.…
A: DNA => Transcription => mRNA => Translation => Protein.
Q: In a DNA molecule, Select one: O A. The nucleotides are covalently bonded to one another. B. The…
A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…
Q: A groove in the DNA refers toa. the indentations where the bases are in contact with thesurrounding…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: Which of the following is false about the types of DNA? A. Z-DNA is right handed double helix. B.…
A: Nucleic acids are the organic materials present in all organisms in the form of DNA or RNA. Nucleic…
Q: 1. a) What does DNA stand for? b)What is the name of the DNA structure?
A: DNA is self replicating by molecules that are present in chromosome and carry in genetic…
Q: DNA double helix is stabilized by ... a) H-bonds between the sugar-phosphate backbones. b)…
A: Answer. Watson and Crick first describe the structure of DNA double helix in 1953 e using x-ray…
Q: The nucleotide sequence in a single strand of DNA represents which level of structure? a.…
A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…
Q: Researchers have proposed that early life on Earth used RNA as its source of genetic information and…
A: There are two types of nucleic acids: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). Most…
Q: Which of the following is NOT a dissimilarity between RNA and DNA? a) Types of bases b)…
A: RNA , DNA : Nucleic acids. RNA : Ribonucleic acid DNA : Deoxyribonucleic acid Both are…
Q: The Watson and Crick model of DNA structure shows A pair bonding between bases a purine and a purine…
A: * The double helical structure of Dna was proposed by Watson and crick * They proposed that The…
Q: The A and B forms of DNA A both have 12 base pairs per turn of the helix B are both right handed…
A: DNA or deoxyribonucleic acid is a polymer made up of nucleotides. It is present in a double-stranded…
Q: Enzymes that break down DNA catalyze the hydrolysis of thecovalent bonds that join nucleotides…
A: Enzymes are biological molecules (typically proteins) that are vital for life and serve a wide range…
Q: If you were told that Martian light chains had a molecular weight of 25,000 daltons, what would you…
A: Antibody (or immunoglobulin) molecules are glycoproteins made up of one or more units, each with two…
Q: A friend tells you that only four differentkinds of bases are found in RNA. What would you say in…
A: RNA : Important biological macromolecule that is present in all biological cells.
Q: Match the function to the respective carbon atom of a nucleotide Carbon 1 Carbon 2 Carbon 3 Carbon 4…
A: Nucleotide refers to the organic molecule that forms the building block of nucleic acids. The…
Q: Which statment below about nucleotides is TRUE ? A. Base pairing occurs between the 5' and 3'…
A: DNA is composed of four nitrogenous bases: Adenine, Guanine, Cytosine, and Thymine. It also contains…
Q: A. Draw a detailed structure of DNA strand using the following sequence of bases 5' A -C- G 3' •…
A: Deoxyribose nucleic acid (DNA) is the genetic material that stores genetic information required for…
Q: For entertainment on a Friday night, a genetics professor proposed that his children diagram a…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: Tabulate the main structural features of DNA and RNA. In one sentence, point out the salient…
A: Nucleic acids are made up of nucleotides. Nucleotides are the monomer units of nucleic acid.…
Q: What would be the implication for the shape of the DNA molecule if a purine was always matchec cross…
A: Purines and pyrimidines are nucleotide bases in DNA . Purine consists of Adenine and Guanine while…
Q: Which is a difference between an alpha-helix and a beta-pleated sheet? Select one: a. An alpha-helix…
A: Secondary structure in a polypeptide chain refers to the regular, recurrent groupings in space of…
Q: Why do we not need to add SDS to RNA or DNA but we do need to add SDS to proteins? a Proteins don’t…
A: SDS stands for Sodium dodecyl sulfate which is a manmade organic compound. It is used in several…
Q: A strand of DNA has the specific sequence ATGGCTA. What would be the sequence of a complimentary…
A:
Q: Which of the following is NOT true of the structure of DNA? a. Nitrogenous bases A and C bond…
A: There are two different genetic material such as DNA and RNA.
Q: , Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT…
A: Note- According to the guidelines, we are supposed to solve first three subparts (a, b and c) of a…
Q: The backbone of DNA molecule is made of? a. nucleotides b. alternating phosphates and bases…
A: DNA is the genetic material in all the living organisms.
Q: What was the contribution of Rosalind Franklin to the discovery of DNA's structure? a.Discovery…
A: DNA is that the chemical name for the molecule that carries genetic directions altogether living…
Q: Given the following DNA strand: TACAGTGATAACCAGATT A. Write the corresponding strand that would form…
A: A) the corresponding strand that would form the other half of the DNA molecule is ATGTCACTATTGGTCTAA…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Explain why scientists preferred proteins as the source of genetic material over DNA. A. DNA seemed too simple of a molecule compared to proteins B. Proteins are made up of combinations of 20 different amino acids compared to DNA's 4 bases. The larger number seemed more likely to account for all the variety and diversity in organisms. C. Scientists knew more about proteins than they did DNA. D. All of the answers are correct explanations.In DNA, nucleotide bonding forms a compound with a characteristic shape known as a(n) ________.a. beta chainb. pleated sheetc. alpha helixd. double helixWhich statement is true about Nucleic Acids? a) DNA is a protein b) DNA is identical to RNA c) RNA has the structure of a double helix d) RNA binds to DNA but not to amino acids e) None of these are true.
- A......of a DNA consists of a sugar, a phosphate, and a nitrogen containing base. A....... is a change in the base sequence of a DNA molecule Took x-ray images of DNA molecule Name 3 types of RNA and list their roles in making proteinsMatch the function to the respective carbon atom of a nucleotide Carbon 1 Carbon 2 Carbon 3 Carbon 4 Carbon 5 A. Connects to the nitrogenous base B. Is connected to the phosphate group C. has no specific role D. Hold either a H or Oh group E. Connect to the 5' end of the next nucleotide in a nucleic acidThe 3’ end of DNA molecule refers to a(n) __________ that can form a phosphodiester bond (a) OH group (b) phosphate group (c) nitrogenous base (d) enzyme (e) hydrogen
- Denaturation of a protein A. adds hydrogen bonds to the primary level of protein structure. B. breaks hydrogen bonds in the primary level of protein structure. C. adds hydrogen bonds to the secondary and tertiary levels of protein structure. D. breaks hydrogen bonds in the secondary and tertiary levels of protein structure.The molecule shown below is a monomer of ________. We know this because of the structure of the carbon labeled _______. a RNA; C b DNA; B c DNA; C d RNA; BThe nucleic acid bases: A)absorb ultraviolet (260 nm) light. B)have all of these described characteristics. C)are roughly planar. D)are relatively hydrophobic. E)have none of these described characteristics.
- Which level(s) of protein structure can you find the α helix and the β pleated sheet? mutiple answer maybe quaternary secondary primary tertiaryI am in Microbiology and the question is how would I turn the following DNA strands to primary protein structure? a. TACCCGGTCAAGGACTCCATT b. TTACCGGCTCCGAATGACTTTTThe type of bonds between the nucleotide bases of the two strands of DNA are a.polar covalent bonds. b.nonpolar covalent bonds. c.hydrogen bonds. d.ionic bonds.
