, Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAG TTA AGG CTC CTA GGT TA 5' a. What would be the first 5 bases at the 3' end of the complementary strarıd? 3'TA ACcs' b. What would be the first 10 bases at the 5' of the complementary strand? I'G TC AAT 1CC C. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair and with respect to the C-G base pair? ien of cvnthesis of:

Q: Which 2 primers will copy the entire sequence of DNA: 5'…

A: Primer is a short nucleotide sequence which is required to initiate DNA replication . To the primers…

Q: If the sequence of bases in one strand of DNA is 5′ TAGCCT 3′,then the sequence of bases in the…

A: Answer is c.)  3'ATCGGA5'.

Q: 1. A short stretch of amino acid residues that connects consecutive strands of an antiparallel sheet…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: Double-helical DNA has major and minor grooves because

A: The question is regarding DNA double helix structure. The structure of a DNA molecule is described…

Q: In Noll’s experiment to test the beads-on-a-string model, exposure of nuclei to a low concentration…

A: Markus Noll's experiment to test the Kornberg's model of Nucleosome, also known as beads-on-string…

Q: Writing a Full Strand: 1. A. Original DNA: CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT…

A: DNA  It is a nucleic acid which carries genetic information that gets passed from one generation to…

Q: You have created a synthetic nucleotide, nucleotide X, which can be substituted into a DNA strand…

A: Introduction  A nucleoside and a phosphate make up nucleotides, which are organic compounds. They…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: Which of the following changes occur with a double-stranded DNA if it is heated to 95°C at neutral…

A: The hereditary substance found in practically all species is DNA or deoxyribonucleic acid. DNA aids…

Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…

A: The central dogma of molecular biology is the metabolic process in which the double-helical…

Q: What is the basis for the difference in how the leading andlagging strands of DNA molecules are…

A: DNA carries the genetic information of the organism stored within the nucleus and also plays a role…

Q: A+ AT D THA E 1. Identify a nucleotide of DNA. 2. Identify the labelled deoxyribose sugar. 3.…

A: Hi, Thanks For Your Question.  Answer : 5 And 6 Are Answered Here, Rest Labelled in Diagram.…

Q: Given the choices, a. 25 b. 18 c. 23 d. 21 how many hydrogen bonds are present in a DNA double…

A: DNA is also known as deoxyribonucleic acid. DNA acts as genetic material in most of the organisms…

Q: A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following…

A: Multiple copies of DNA copies can be achieved with the polymerase chain reaction in large amounts of…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.

Q: For numbers 1-3 refer to the statement: The following is the base sequence on one strand of a DNA…

A: "Since you have asked multiple questions, we are eligible to answer only the first three parts.…

Q: Given the banding pattern from the gel electrophoresis below, the nucleotide sequence of this…

A: Gel-electrophoresis:- it is a technique used for the separation of charged molecules such as DNA,…

Q: The helix of an A-DNA differs from the helix of a B-DNA in all of the following EXCEPT which phrase?…

A: DNA (deoxyribonucleic acid) is a type of nucleic acid, which acts as the genetic material. A-DNA,…

Q: Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’…

A: Nucleus is main controller of the cell which carries genetic instructions . It contain Chromosome…

Q: If the sequence of bases on the one of the strand of a DNA molecule 5’ATTGCGGA - 3’ What is the…

A: DNA is a double helical structure composed of nucleotides.The two helices are joined together by…

Q: A primer is laid down complementary to the DNA sequence TAGCAATCGCA to prime synthesis of a daughter…

A: Answer: Introduction: In living organisms, primers are short strands of RNA or DNA commonly 18-22…

Q: There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with…

A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of multiple…

Q: given double stranded DNA undergoes enzymatic hydrolysis targeting only the "b" side in the…

A: Introduction The DNA helix acts as a template for its own duplication. Because the nucleotide A will…

Q: Given: 3' TAC CAG TTA AGC CTC GGT ATC CAG GAT ACG 5' What would be the first 10 bases at the 5' end…

A: DNA replication is the process of new DNA synthesis from the old DNA by semiconservative mode that…

Q: On paper, replicate the following segment of DNA:            5’ A T C G G C T A C G T T C A C 3’…

A: DNA replication is a complex process of producing copies of the entire chromosome using the…

Q: Given the banding pattern from the gel electrophoresis below, the nucleotide sequence of this…

A: Gel electrophoresis:- it is a technique through which DNA, RNA, or protein can be separated. When we…

Q: A circular, double-stranded DNA contains 2100 base pairs. The solution conditions are such that DNA…

A: Linking number is the topological property of . Linking number is a total of twists and writhes. The…

Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…

A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus controls…

Q: When a double-stranded DNA molecule is exposed tohigh temperature, the two strands separate, and…

A: Hi! Thanks for your question. I am answering only the first question, as the image is not given in…

Q: How many hydrogen bonds are present in a DNA double helix fragment consisting of the following…

A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…

Q: Explain, If the template strand of a DNA is 3’-ATCATG-5’, what will be the complementary strand?

A: The DNA or deoxyribonucleic acid is the genetic material of all the living organisms and it is…

Q: Which of the following pairs of base sequences could form ashort stretch of a normal double helix of…

A: Deoxyribonucleic acid (DNA) is the hereditary material present in humans and almost all organisms.…

Q: Which statement about nonpolar interactions in the formation of the DNA double helix is INCORRECT?…

A: Deoxyribose Nucleic Acid (DNA) is a nucleic acid that acts as the genetic material in all organisms…

Q: unknown coding strand of the DNA can be easily determined. G A T с ||_ |||||| | || <|||| | |_|| | ||…

A: Introduction  There are two types of nucleic acids are present in our body, DNA and RNA. DNA acts as…

Q: Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it…

A: A heritable genetic change in the genetic material of an organism that gives rise to alternate…

Q: In the Watson-Crick structure of DNA, the: a. adenine content of one strand must equal the thymine…

A: Watson and Crick model of DNA has two strands that wound around each other and form double hellicle…

Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the…

A: Here in question, I believe “a” side in Phosphodiester bond refer to the side bond to 3’-C atom of…

Q: Examine the strand of DNA below. 3' CCTAGGCTGCAATCC5' 5'GGATCCGACGTTAGG3' An RNA primer is formed…

A: Here DNA templare strand is 3' - 5' .  So RNA primer formed from 5' - 3' .  Now primer sequence…

Q: Which of the following DNA strands (oligonucleotides) would have a higher melting temperature?…

A: DNA is a double helical molecule which is found in the cells of living organisms.  The two strands…

Q: Here is the sequence of a portion of one strand of DNA: 5'-GTCCTAACGACTGATCGT-3' a. What is the…

A: According to the central DNA is converted to RNA (transcription) and RNA to protein (translation).…

Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…

A: DNA has a double helix structure composed of sugar, phosphate group, and four nitrogen bases.…

Q: Below is a nucleotide base pair from B-DNA with three different regions indicated by A, B, and C. C…

A: If we represent the nitrogen base as a triangle, there are going to be three edges: Hoogstein Edge:…

Q: How would the uniform 2 nm diameter of DNA be affected iftwo purines or two pyrimidines could pair…

A: DNA is called deoxyribonucleic acid. DNA is found in the genome of most of the organism. DNA stores…

Q: When the helix axis of a closed circular duplex DNA of 2310 bp is constrained to lie in a plane, the…

A: DNA molecules have different conformational changes based upon its state that could be described by…

Q: In sea urchin DNA, which is double stranded, 17.5percent of the bases were shown to be cytosine (C).…

A: Chargaff's rule expresses that DNA from any organism ought to have a 1:1 stoichiometric proportion…

Q: Given the banding pattern from the gel electrophoresis below, the nucleotide sequence of this…

A: Gel-electrophoresis:- it is used to separate the fragments of DNA, RNA, as well as proteins on the…

Q: If part of a gene had the base sequence TGC CAT, what would be the base sequence of the…

A: DNA (Deoxyribonucleic acid) is one of the nucleic acid elements which contains the genetic…

Q: Given the banding pattern from the gel electrophoresis below, the nucleotide sequence of this…

A: Electrophoresis separates the DNA strands based on their size. Thus, the smaller fragments sieve…