The image shows a normal chromosome and a mutated chromosome with the gene for hair type labele gene curly hair curly hair normal mutated chromosome chromosome What can be concluded about this mutation? The mutation is neutral because it does not reduce the length of the hair. The mutation is neutral because it results in the same trait. The mutation will have harmful effect because it alters the DNA. The mutation will have a beneficial effect because it alters the DNA.

The image shows a normal chromosome and a mutated chromosome with the gene for hair type labele gene curly hair curly hair normal mutated chromosome chromosome What can be concluded about this mutation? The mutation is neutral because it does not reduce the length of the hair. The mutation is neutral because it results in the same trait. The mutation will have harmful effect because it alters the DNA. The mutation will have a beneficial effect because it alters the DNA.

Name: The image shows a normal chromosome and a mutated chromosome with the
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: The image shows a normal chromosome and a mutated chromosome with the gene for hair type labeled.genecurlyhaircurlyhairnormalmutatedchromosome chromosomeWhat can be concluded about this mutation?The mutation is neutral because it does not reduce the

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter13: Genes, Chromosomes, And Human Genetics

Section: Chapter Questions

Problem 3ITD

See similar textbooks

Similar questions

A chromosome has the following segments, where • represents the centromere:A B C D E • F G What types of chromosome mutations are required to change this chromosome into each of the following chromosomes? (In some cases, more than one chromosome mutation may be required.) a. A B E • F G b. A E D C B • F G c. A B A B C D E • F G d. A F • E D C B G e. A B C D E E D C • F G
A chromosome territory is a region along a chromosome where many genes are clustered. along a chromosome where the nucleosomes are close together. in a cell nucleus where a single chromosome is located. in a cell nucleus where multiple chromosomes are located.
A chromosome has the following segments, where • represents the centromere: A B • C D E F G What types of chromosome mutations are required to change this chromosome into each of the following chromosomes? (In some cases, more than one chromosome mutation may be required.) a. A B A B • C D E F G b. A B • C D E A B F G c. A B • C F E D G d. A • C D E F G e. A B • C D E f. A B • E D C F G g. C • B A D E F G h. A B • C F E D F E D G i. A B • C D E F C D F E G
Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.
The microscope image above shows the human chromosomes from a white blood cell. To create the image, researchers put cells in culture under conditions that encourage the cells to divide. They bathed the cells in a hypotonic (low salt) solution, which caused the cells to swell until their plasma membrane burst open. They "squashed" the chromosomes to spread them out, and stained them with a dye to make them visible under the microscope. Human chromosomes are numbered from longest (1) to shortest (22) plus the sex chromosomes X and Y. In the image chromosome 1 is about 7 micrometers. Answer the following questions. 1) What word(s) in the description above indicates that the chromosomes are not from a cell undergoing meiosis? 2) Based on the size, shape and appearance of the chromosomes in the image, in what cell cycle stage was the cell that the chromosomes came from? How can you tell? 3) Does the image suggest that centromere sequences are always located in the middle of a…
Genetic disorders can be caused by __________. a. gene mutations b. changes in chromosome structure c. changes in chromosome number d. all of the above
A chromosomes structure can be altered by _______. a. deletions b. duplications c. translocations d. all of the above
Which of the following is an example of a balanced mutation? Group of answer choices inversions deletions aneuploidy tandem duplications
"Mutations that are inherited according to Mendelian rules affect nuclear genes; mutations whose inheritance violates Mendelian rules are likely to affect organelle genes." is true or false.
What types of chromosome mutations are required to change this chromosome into the following chromosomes? (In some cases, more than one chromosome mutation may be required.) Q. A B • C F E D G
A chromosome initially has the following segments:A B • C D E F G Draw the chromosome, identifying its segments, that would result from the following mutations. Q.Deletion of FG
A chromosome initially has the following segments:A B • C D E F G Draw the chromosome, identifying its segments, that would result from the following mutations. Q. Pericentric inversion of BCDE