Q: Differences Between Prokaryotes and Eukaryotes in the Details of Gene Expression
A: The gene expression is a biological process in which information from the gene is used for the…
Q: In Eukaryotes,How the Nuclear MembranePrevents the Coupling of Transcriptionand Translation
A: Coupling of transcription and translation occurs in prokaryotic cell.
Q: the ____________ is a net-like structure of intermediate filaments that supports the structure of…
A: Intermediate filaments that consist of proteins in them are important components of the cell system…
Q: n disrupt formation of spindle apparatus resulting in abnormal polyploidy, which cytoskeleton…
A: Polyploidy is the mechanism of presence of multiple set of chromosomes in a cell. It is an abnormal…
Q: How treatments for treacher Collins Syndrome may help ribosomes do its job
A: Treacher Collins syndrome (TCS) is craniofacial disorder condition in which non development of some…
Q: How treatments for treacher Collins Syndrome help ribosomes do its job
A: Treacher Collins syndrome (TCS) is a condition that affects the development of bones and other…
Q: What is induce nuclear envelope breakdown inmost eukaryotes by phosphorylating lamins.
A: Cell is the smallest structural and, functional unit of life. It is simple machinery that houses all…
Q: *Complete cell cycle table* Cytokinesis in Plant Cells • A plant cell has a rigid cell wall covering…
A: Cell division is the process by which a parent cell divides into two or more daughter cells. Cell…
Q: Intracellular morphogens 1. 2. 3. 4. 1. 2. 3. 4. 234 Extracellular morphogens
A: Morphogens are the signallung molecules thar spread through the developing tissues and results in…
Q: different components of prokaryotic and eukaryotic cells which of these in plants or animals cells.
A: Prokaryotes are characterized by single-celled (unicellular) microorganisms that lack a nucleus or…
Q: eukaryotes control transcription
A: Transcription in the eukaryotic cells is controlled by various ranges of regulation in which the…
Q: Gelatinase Liquification or no change: _____________________________ Gelatinase produced, +/-:…
A: Gelatin is a collagen-derived protein produced from the "connective tissues" of animals. When…
Q: locate the metaphase (use arrow please) then describe the appearance of the DNA, spindle fibers and…
A: The cell division has the following phases: prophase, metaphase, anaphase, and telophase. After the…
Q: mitosis. Growth Rate of Rapidly Dividing Human Liver Cell Time (hours) Number of cells 1 10 2 20 4…
A: Given the table regarding the growth time and number of cells .
Q: Chromosomes attach to the spindle during
A: Phases of cell division include : Prophase Metaphase Anaphase Telophase Option a ( anaphase )…
Q: Growth Rate of Rapidly Dividing Human Liver Cell Time (hours) Number of cells 10 20 4 30 8. 40 16 50…
A: A process in which a single cell is divided into two identical daughter cells is known as Mitosis.…
Q: ribosome funtion in plants and animals
A: Ribosomes are sphere-shaped structure within the cytoplasm of the cell, which are composed of…
Q: Centrioles found in plant only ,that help divide the cell during cell * .division True O False O
A: Centrioles are paired barrel-shaped organelles located in the cytoplasm of animal cells near the…
Q: Part 1 of 2: Starting from the mRNA that is produced and released into the cytosol, describe in…
A: Translation is the process in which the base sequence of mRNA is utilized to order and join the…
Q: Which letter in the diagram below is pointing to the anticodon
A: A trinucleotide sequence that is complementary to a corresponding codon in a messenger RNA sequence…
Q: PROPHASE OF PLANT CELL
A: Cell division is the process by which a cell divide to form new daughter cells. It occurs mainly in…
Q: organelle functions in cellular respiration
A: Cellular respiration is a metabolic process in which glucose is broken down to form ATP, the energy…
Q: DNOLATION. Label on the diagram where Transcription & Translation take place. PROTEIN SYNTHESIS…
A: Central dogma of molecular biology: It states that the DNA which contains the genes are…
Q: To review: The mechanism by which the DNA damage suffered in S phase could be repaired in a cell…
A: The cell cycle is a highly regulated mechanism that regulates how cells advance from one phase to…
Q: why Some Organisms Exhibit BiparentalInheritance of Organellar Genomes
A: Extranuclear inheritance is also known as cytoplasmic inheritance. It is the transmission of genes…
Q: What are two factors that can influence a yeast cell’s decision to initiate a new round of the cell…
A: The eukaryotic cell cycle is a complex biological mechanism that has characterized several…
Q: The capsule surrounding most of eukaryotic cells.
A: Introduction -- All living organisms are composed of functional and fundamental unit of body known…
Q: SOMATIC CELL DIVIS SPECIES, EA CH WITH A DIFFERENT NUMBER OF CHROMOSOMES * Part IV. Images The…
A: Haploid describes a cell that contains a single set of chromosomes. Diploid is a cell or organism…
Q: Colchicine is a poison that acts to inhibit the development of spindle fibres. Describe the effects…
A: Introduction: Colchicine is a medicine taken orally for the treatments of gouts and Bechet's…
Q: Defend or attack this statement: “All eukaryotic promoters have TATA boxes.”
A: Promoter is defined as DNA region where initiation of gene transcription takes place. They regulate…
Q: The elements that present in Protoplasm
A: A cell's protoplasm, cytoplasm, and nucleus are all examples of protoplasm. The phrase was first…
Q: Nudeus Which statement describes the process depicted in the figure? The nuclear envelope and…
A: The endosymbiotic theory states that some of the organelles in eukaryotic cells were once…
Q: The chromosome shown below is __ . O prokaryotic
A: Chromosomes is a complex of DNA and protein present inside nucleus of cells. They consist of packed…
Q: How the ribosomes affected in Treacher Collins Syndrome, causes problems and cannot do it's normal…
A: Treacher Collins syndrome is an inherited genetic disease condition in which the bones and tissues…
Q: Organelle that is affected by the treacher collins syndrome and normal job of that organelle
A: Introduction :- Treacher collins syndrome is an rare genetic disorder characterised by distinctive…
Q: State 3 ways that RNA is directly involved in protien production.
A: The three types of RNA (ribonucleic acid) that take part in the process of protein synthesis are…
Q: suggest a reason why it would be advantageous for eukaryotic cells to evolve elaborate internal…
A: Eukaryotes comprise several organelles that are membrane-bound. This helps the cells in…
Q: TELOPHASE OF ANIMAL CELL describe the appearance of DNA, spindle fibers and location of the…
A: Cell division is a process in which cell divides to give two or more cells. There are two types of…
Q: Differences in Gene Expression BetweenProkaryotes and Eukaryotes
A: Gene expression means genes express its function like DNA carry information can be express as…
Q: parts of a prokaryotic chromosomes that move to opposite of ends of the cell during cell division.
A: A prokaryote is a unicellular organism that does not have a nuclear membrane-enclosed nucleus.
Q: HOW Prokaryotes and Eukaryotes InitiateTranslation Differently
A: Prokaryotes are the organisms that lack the cell nucleus and membrane-bound organelles. They have…
Q: Why Nucleosome Is considered to be the Fundamental Unitof Chromosome Packaging
A: Nucleosome is the structural unit of a chromosome. It denotes the fundamental sub-unit of a…
Q: analysis of eukaryotic cells and how they differ from prokaryotic cells.
A: Eukaryotic cells include plant cells and animal cells and they differ from each other by the…
Q: why Both mitochondria and chloroplasts have their ownDNA
A: Mitochondria are cell organelles found in plants and animal cells, which serve the purpose of…
Q: Organelle Biochemical Process Importance storage of genetic material site for ribosome…
A: Organelles are specialized structures found inside cells that perform a variety of tasks. "Little…
Q: describe the appearance of DNA, spindle fibers and location of the chromosomes
A: Cell division is an important part of cell biology. It is the process by which a single cell divides…
Q: In Figure 6-13, explain at the protein level why this heterokaryon can grow on minimal medium
A: Complementation results when two mutated cells combine together to give rise to a wild-type normal…
Q: etermine what happens as if the spindle fiber failed to form in a cell during the process of mit
A: Spindle fibres are the proteins that give chromosomes structure and organisation by serving as an…
Q: Part 3: Three Types of RNA THREE one amino acids ribosome gene * There are types of RNA. Complete…
A: RNA is the ribonucleic acid it is made up of nucleotides polymer. a nucleotides is made up of…
Step by step
Solved in 2 steps
- A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new nucleotide sequence with the change in bold. 3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’ what type of mutation is this? Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?Researchers have successfully used gene therapy toameliorate some human genetic diseases by adding anormal gene copy to cells whose genomes originallyhad only nonfunctional mutant copies of that gene.For example, a form of blindness due to the lack of asingle protein called RPE65 has been reversed byintroduction of a normal RPE65 gene to cells of theretina of adults.a. The success of this gene therapy approach providesus with clues about the role of the RPE65 proteinin the retina. Do you think that RPE65 is neededfor the proper development of the human eye?b. Can you see a potential difficulty in applying this genetherapy approach for diseases like microcephaly?Retinoblastoma is a rare cancer in which tumors developin the retina of the eye. The tumors arise because of theloss of the Rb gene, which codes for a tumor suppressor.Hereditary retinoblastoma usually appears in children whohave inherited only one functional copy of Rb. Explain whythe nonhereditary form of retinoblastoma usually occurs laterin life.
- Cystic Fibrosis is a genetically heritable disease caused by the loss of the chloride channel, CFTR. Studies of this gene have found that the Gene includes 250,000bp in the DNA. Scientists found that the mRNA had 6,500 nucleotides, and the final protein had 1480 amino acids. How much of the mRNA is untranslated? How much of the RNA that is produced does not leave the nucleus? One of the mutations that results in a disease phenotype can be easily identified because the mutation results in a much longer mRNA then normal. Where would you look for this mutation? What might this mutation have affected?ABOUT Phenylketonuria Explain Potential technical issues and limitations of PCR technology are mentioned Correct information about tissue that can be used to test for a genetic disease and justification of tissue selection Detailed information about the position (exact base pair number) of the new mutation relative to the sequence of the PAH gene. Numbering is based on the start of transcription of the PAH gene. PLEASE ANSWER ALLLL PLEASEEMany viruses contain their own enzymes for replicating theirgenetic material, whereas others use the host cell’s enzymes.Would DNA viruses or RNA viruses be more likely to producetheir own enzyme(s) for this purpose, and why?
- Homozygosity for extremely rare mutations in a humangene called SCN9A cause complete insensitivity topain (congenital pain insensitivity or CPA) and a totallack of the sense of smell (anosmia). The SCN9A geneencodes a sodium channel protein required for transmission of electrical signals from particular nerves inthe body to the brain. The failure to feel pain is a dangerous condition as people cannot sense injuries.The SCN9A gene has 26 exons and encodes a1977-amino acid polypeptide. Consanguineous matings in three different families have resulted in individuals with CPA/anosmia. In Family 1, a G-to-Atransition in exon 15 results in a truncated protein that is898 amino acids long; in Family 2, deletion of a singlebase results in a 766-amino acid polypeptide; and inFamily 3, a C-to-G transversion in exon 10 yields a458-amino acid protein.a. Hypothesize as to how each of the three SCN9Amutations affects gene structure: Why are truncatedproteins made in each case? b. How would you…CATCTACAAATAGCACCTAATTGTG What is the MRNA What is the protein What is the phenotype: The effects of DNA mutations within the p53 gene on the structure and function of the protein encoded by the gene. The essay should focus on the following discussion points: The normal functions of the p53 gene. Known mutations of the gene. The impact of mutations on the structure of the protein encoded by the gene. The impact of mutations on the function of the protein. Current therapeutic interventions that aim to address the impact of mutations on gene function
- . While perusing the E. coli K12 genome sequence,you come across a gene with no known function. Theamino acid sequence of the gene’s protein productshows weak similarities with known porins, proteinsthat cross a cellular membrane to let molecules suchas amino acid or sugar nutrients (or drugs like penicillin) pass through. Some porins are nonspecific and letany solute up to a certain size transit into the cell.Other porins are specific and allow the transit ofcertain sugars but not others. What genetic experiments could you do to try to determine whether thisnew gene has a specific function in allowing bacterialcells to scavenge the sugar maltose from the environment? Describe scenarios that might complicate yourexperimental approach.Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAAThe family of a sixth-grade boy in Palo Alto, California, wasinformed by school administrators that he would have to transferout of his middle school because they believed his mutation ofthe CFTR gene, which does not produce any symptoms associatedwith cystic fibrosis, posed a risk to other students at the schoolwho have cystic fibrosis. After missing 11 days of school, a settlementwas reached to have the boy return to school. What ethicalproblems might you associate with this example?