Part 1 of 2: Starting from the mRNA that is produced and released into the cytosol, describe in detail how the protein is translated and where this occursProtein : B-hexoaminidaseLocation: Lysosome Having made it through Cell Molecular Biology this far, you are now an expert on cells andtheir molecular mechanisms. There are approximately 10,000 proteins in a typical cell thatare synthesized through different routes of intracellular protein trafficking. Each of you willbe given a different protein and its final location in the cell. Starting from the MRNA that isproduced and released into the cytosol, describe in detail how the protein is translated andwhere this occurs. Additionally, describe how the protein is being processed and where,along with how it is being transported or further processed until it reaches its finaldestination. Depending on your protein, many will have very different routes that they follow.

Name: Part 1 of 2: Starting from the mRNA that is produced and released into
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Part 1 of 2: Starting from the mRNA that is produced and released into the cytosol, describe in detail how the protein is translated and where this occursProtein : B-hexoaminidaseLocation: Lysosome Having made it through Cell Molecular Biology this f

Translation is the process in which the base sequence of mRNA is utilized to order and join the…

Answered: Part 1 of 2: Starting from the mRNA…

Science

Biology

Part 1 of 2: Starting from the mRNA that is produced and released into the cytosol, describe in detail how the protein is translated and where this occurs Protein : B-hexoaminidase Location: Lysosome

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 13QP: Suppose that in the formation of phenylalanine hydroxylase mRNA, the exons of the pre-mRNA fail to...

See similar textbooks

Similar questions

Thousands of caspase substrateshave been identified. Which onesare the critical proteins that mustbe cleaved to trigger the majorcell remodeling events underlyingapoptosis?
Imagine protein X, destined to span theplasma membrane. Assume that the mRNA carrying the geneticmessage for protein X has already been translated by ribosomesin a cell culture. If you fractionate the cells (see Figure 6.4), inwhich fraction would you find protein X? Explain by describingits transit through the cell.
It is not an easy matter to assign particular func-tions to specific components of the basal lamina, sincethe overall structure is a complicated composite materialwith both mechanical and signaling properties. Nidogen,for example, cross-links two central components of thebasal lamina by binding to the laminin γ-1 chain and totype IV collagen. Given such a key role, it was surprisingthat mice with a homozygous knockout of the gene fornidogen-1 were entirely healthy, with no abnormal phe-notype. Similarly, mice homozygous for a knockout of thegene for nidogen-2 also appeared completely normal. Bycontrast, mice that were homozygous for a defined muta-tion in the gene for laminin γ-1, which eliminated just thebinding site for nidogen, died at birth with severe defectsin lung and kidney formation. The mutant portion of thelaminin γ-1 chain is thought to have no other functionthan to bind nidogen, and does not affect laminin struc-ture or its ability to assemble into the basal lamina.…
When the DNA of a human cell becomes damaged, the p53 geneis activated. What is the general function of the p53 protein?Is it an enzyme, transcription factor, cell-cycle protein, orsomething else? Describe three ways in which the synthesisof the p53 protein affects cellular function. Why is it beneficialfor these three things to happen when a cell’s DNA hasbeen damaged?
As we learned when studying protein trafficking, proteins need a nuclear localization signal in order to move from the cytosol into the nucleus via the nuclear pore complex. Protein A contains a typical nuclear localization signal but surprisingly is usually found in the cytosol. When the cell is exposed to a certain hormone, protein A moves from the cytosol into the nucleus, where it turns on genes involved in cell division.When you purify protein A from cells that have not been treated with the hormone, you find that protein B is always complexed with it. To determine the function of protein B, you engineer cells lacking the gene for protein B. You compare normal and gene B deletion cells by separating and isolating the proteins found in the cytoplasm and those found in the nucleus. You then run these proteins on a protein electrophoresis gel to separate them by size. You identify the presence of protein A and protein B by looking for their characteristic bands on the gel (which is…
What is unique about the translocation of ER proteins into the ER lumen vs. the translocation of proteins across other organelle membranes?
How are actin-regulatory proteinscontrolled spatially in the cytoplasm togenerate multiple distinct types of actinarrays in the same cell?
Assume that during the process of creating the SHH protein an error was made. Instead of producing a 462-amino-acid-long protein, you only make a 20-amino-acid-long protein. Assume the error is detected in the Golgi apparatus. Will this protein be exported into the extracellular space? If your answer is no, what will happen to this protein?
I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…
A human gene called theCFTR gene (for cystic fibrosis transmembrane regulator) encodes aprotein that functions in the transport of chloride ions across the cellmembrane. Most people have two copies of a functional CFTR geneand do not have cystic fibrosis. However, a mutant version of the CFTRgene is found in some people. If a person has two mutant copies ofthe gene, he or she develops the disease known as cystic fibrosis. Arethe following descriptions of this disease related to genetics at themolecular, cellular, organism, or population level?A. People with cystic fibrosis have lung problems due to a buildupof thick mucus in their lungs.B. The mutant CFTR gene encodes a defective chloride transporter.C. A defect in the chloride transporter causes a salt imbalance inlung cells.D. Scientists have wondered why the mutant CFTR gene is relativelycommon. In fact, it is the most common mutant gene that causesa severe disease in persons of Northern European descent. Onepossible explanation why…
How is it possible that a given mRNA in a cell is found throughoutthe cytoplasm but the protein that it encodes is only found in afew specific regions?
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.