The RNA complement of a protein coding gene is what? A) mRNA B) rRNA C) snRNA D) tRNA

Q: What is the complementary hnRNA base sequence produced from the DNA base sequence 5' C-T-A-T-A-C 3'?…

A: As per our guidelines we are supposed to answer only 3 sub parts.

Q: Alternative splicing a. increases the number of proteins made from one gene b. increases the number…

A: in alternative splicing there is a selection of different types of sites of splicing which can…

Q: What ensures fidelity in protein synthesis? How does this compare with the fidelity of replication…

A: Protein synthesis is the last step of the central dogma. It occurs after the replication of DNA and…

Q: Which is true about eukaryotic cDNA? Choose all that apply.    a.  it is constructed from mRNA that…

A: Complementary DNA (cDNA) is made from messenger RNA in the laboratory for various purposes. Because…

Q: What is a closed genome?

A: A pan-genome is also called as supragenome, which is the entire set of genes for all strains of…

Q: What is the process known as reverse transcriptase.?

A: 'Reverse' means opposite. Transcription is the process of RNA synthesis from DNA. Transcriptase is…

Q: Which transcription systems that require TBP?

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: What is a gene? Why are genes for rRNA and tRNA considered to be genes even though they do not…

A: Structurally, RNA (RNA), is kind of like sugar Nucleic Acid(DNA). However, whereas polymer molecules…

Q: What does the BCR gene do?

A: A short-portion of the DNA is termed as a gene. The genes are the essential functions as well as…

Q: How does ribosomal frameshifting allow for two different proteins to be translated from the same…

A: Ribosomal frameshifting is the process in the translation step where multiple copies of proteins are…

Q: What does the SHOX gene do?

A: SHOX gene stands for the short-stature homeobox gene. The mutation in the aforementioned gene…

Q: Why is TBP considered to be a universal transcription factor?

A: The TATA-binding protein is a general transcription factor that binds specifically to a DNA sequence…

Q: CCGGTGTACACAGGGACCATTCGATTA What is the mRNA:? Protein Phenotype?

A: The sequence of a protein is usually notated as a string of letters, according to the order of the…

Q: What serves as the template for making new MRNA?

A: In transcription process a template strand  is used to make a new RNA.

Q: What exactly is a genome?

A: DNA is the hereditary or genetic material present in most of the living organisms. It is majorly…

Q: What is the substrate for RNA synthesis? How is this substrate modified and joined together to…

A: RNA is known as Ribonucleic acid.

Q: . What is a consensus sequence?

A: Genes are the typical genomic sequence which undergoes transcription to produce the different types…

Q: GENERAL DNA SEQUENCE 3' TAC CGC TTA CGT CTG ATC GCT 5'…

A: Introduction In most organisms, genetic material is stored in the form of DNA in every cell of the…

Q: If a diagnostic procedure turns into a surgical procedure, how is it coded?

A: If a diagnostic laparoscopy results in an open surgical procedure, one probably report the…

Q: Please choose the correct answer. The transcriptional complement of the DNA strand with the code 3’…

A: Transcription is the process in which DNA is copied to RNA. Translation is the process of making…

Q: What are Bacterial Insertion Sequences?

A: Insertion sequences are examples of transposable elements.

Q: What could a eukaryotic cell do during the transcription or translation process to stop a certain…

A: DNA is composed of various nucleotides that store genetic information in it. DNA is packed into a…

Q: Given the template DNA sequence:  3’ - TAC - CAG - GTT - ACC - ATC - 5’    A.) What will be the…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: How many types of promoters are there?

A: Promoters are DNA sequences that determine where the gene transcription by RNA polymerase begins.…

Q: What are the differences between hnRNAs, snRNAs, miRNAs, siRNAs, and snoRNAs?

A: hnRNAs, snRNAs, miRNAs, siRNAs, and snoRNAs are the different classes of small RNAs involved in…

Q: if the following DNA sequence were transcribed, which of the following describes the output of this…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: What is gene gun ?

A: The technique of tissue culture is used for genetic engineering. In this method tissue samples are…

Q: What is the difference between a paralog and an ortholog?

A: Phylogeny: It is the study of relationships among different organisms and their evolutionary…

Q: How do we call the type of point mutation in which an A->U change occurs in the codon for the sixth…

A: Gene mutation involve alterations in the structure of genes which alters or modified the structure…

Q: Which type of RNA is the biggest? Which is the smallest?

A: RNA or ribonucleic acid is a polymer of nucleotides. The nucleotides are linked together by means of…

Q: A virus is a submicroscopic infectious agent that replicates only inside the living cells of an…

A: A virus is submicroscopic infectious agent that replicates inside the living cell.  Different…

Q: what features do RNA and DNA have in common? and genes are copied into RNA during what process?

A: DNA stands for deoxyribose Nucleic acid and RNA stand for Ribonucleic acid. DNA have double-helical…

Q: Which of the following is the definition of a gene?   A. RNA that delivers amino acids to a ribosome…

A: Genetics is a science of the study of genes. It involves the identification of specific genes for…

Q: What is a segmented genome?

A: The complete genetic information of an individual is called a genome.

Q: When was gene gun invented?

A: Direct gene transfer can occur via physical or chemical methods.  Physical methods of gene transfer…

Q: Is an ORF a gene?

A: Genes carry coded genetic information in the form of specific nucleotide sequences. This specific…

Q: Who created the gene gun?

A: Any of the various substances that are generated by living organisms and cells are called…

Q: Messenger RNA is single-stranded molecule while tRNA and rRNA molecules are double-stranded…

A: massanger RNA (mRNA) molecules convey the coding successions for protein union and are called…

Q: What is the function of reverse transcriptase in retroviruses?     converts host cell RNA into…

A: Retroviruses are single stranded RNA virus which used RNA as its genetic material.

Q: What is gene targeting? Give some examples of gene targeting?

A: Gene is a stretch of DNA in a chromosome  which codes for a functional product either in the form of…

Q: Which type of snoRNA causes an rRNA to be methylated?

A: DNA methylation is a biological cycle by which methyl groups are added to the DNA (deoxyribonucleic…

Q: What is gene targeting?

A: A gene is the basic functional and physical unit of heredity. Genes are made of substance called…

Q: ction of transfer of genetic information in all living things is as follows:   A. pRNA--> DNA-->…

A: The genetic material is the identity of an organism. The materials are found in the nucleus,…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.