What serves as the template for making new MRNA?

Q: Which enzyme removes a phosphate from the 5' end of the MRNA, leaving two phosphates?

A: mRNA is a messenger RNA, it is a single stranded RNA which carries the genetic sequence of the DNA…

Q: Why is it that pre-mRNAs are capped, but tRNAs and rRNAs are not?

A: Ribonucleic acid (RNA) is a polymeric molecule important in various biological roles such as…

Q: How is mRNA interpreted by the translation apparatus?

A: Gene expression can be defined as the process that uses genetic information for the synthesis of any…

Q: What is polycistronic mRNA ?

A: Polycistronic mRNA is a characteristic feature of prokaryotes but they are also present in…

Q: What are polycistronic mRNAs?

A: Transcription refers to the process of synthesizing the RNA from the template of DNA…

Q: How does RNA polymerase know where to begin transcription?

A: The Terminator region of the DNA helps the RNA polymerase to end the transcription. Sigma factor…

Q: What is the 5′ cap? How is the 5′ cap added to eukaryotic pre-mRNA? What is the function of the 5′…

A: The process of maturation of eukaryotic mRNA from primary mRNA transcripts is known as RNA…

Q: Explain how precursor mRNA is modified to produce mRNA.

A: The central dogma of molecular biology briefs that DNA has instructions to synthesise proteins which…

Q: what is it called when an mRNA is edited and where does it happen?

A: Commonly it’s known that mRNA is produced during the process of transcription which will then go for…

Q: What is a regulatory gene?

A: Regulatory genes are those genes which control the expression of other genes. Regulatory gene codes…

Q: How is pre-mRNA processing regulated? Give examples

A: pre- mRNA processing regulated : pre- mRNA processing events are  1) 5' capping  2) Polyadenylation…

Q: How geneticists used synthetic mRNAs to limit the coding possibilities?

A: Prior to the technology existed for RNA synthesis of defined sequence such as given in the figure…

Q: CCGGTGTACACAGGGACCATTCGATTA What is the mRNA:? Protein Phenotype?

A: The sequence of a protein is usually notated as a string of letters, according to the order of the…

Q: What is the mRNA for a Coding Strand of TAT?

A:

Q: Is the transcription of RNA from a DNA template perfect?

A:

Q: Is there a start codon instead of AUG? What is its name and what does it encode?

A: A reading frame includes a start codon and a stop codon.

Q: how can you find genes that are cotranscribed on a single mRNA?

A: Operon model: it had been given by jacob and Monod. this can be only applicable in prokaryotes as in…

Q: How are introns spliced out to make mature RNA?

A: Introns are the non-coding sequence in the DNA. These sequences are also transcribed into mRNA.…

Q: What is the substrate for RNA synthesis? How is this substrate modified and joined together to…

A: RNA is known as Ribonucleic acid.

Q: What is RNA editing, how can it increase the number of proteins that can be formed from a single…

A: RNA editing also participated in the variations of proteomics sequence. In many types of cancers…

Q: How do bacteria ensure the start codon of the mRNA is positioned properly during translation…

A: The translation is defined as the process that generates a new polypeptide from mRNA with the help…

Q: How is the poly(A) tail added to pre-mRNA? What is the purpose of the poly(A) tail?

A: Transcription is the first of several steps of DNA based gene expression in which a particular…

Q: How to synthesize mRNA ?

A: All cells employ replication, transcription, and translation to maintain track of their genetic…

Q: Where does miRNA fit into gene expression?

A: Gene is the primary unit of heredity of all living beings. It undergoes some modification process…

Q: Could two mRNAs have different nucleotide sequences and yet code for the same protein?

A: To synthesize protein molecules, a cell must first transfer information from DNA to mRNA through the…

Q: What are riboswitches? How do they control gene expression?

A: Riboswitches are parts of messenger RNA which can control the expression of genes. We can find it in…

Q: What is antisense RNA? How does it affect the translation of a complementary mRNA?

A: The DNA is replicated via a process called DNA replication. After this process, the DNA enters in…

Q: How do siRNAs and miRNAs target specific mRNAs for degradation or for the repression of translation?

A: MicroRNAs or miRNAs are a group of small (about 22 nucleotides) noncoding RNAs that participate in…

Q: What are the three primary regions of mRNA sequences in bacterial cells?

A: DNA carries the genetic information for the protein production in the body. DNA decoded into mRNA,…

Q: How do both bacteria and eukaryotes control whether mRNA gets translated?  Describe how mRNA and…

A: mRNA is a single stranded RNA molecule that is complementary to one of the DNA strands of a gene. It…

Q: What would happen if an intron wasn't taken out before translation? And are there

A: DNA contains many sequences such as promoters, introns and exons. Some sequences in DNA are supposed…

Q: How many different polypeptides can be producedthrough alternative splicing of the same pre-mRNA?

A: Maturation of eukaryotic mRNA often entails the removal of RNA sequences (introns or intervening…

Q: What are the nucleotides of the mRNA from gene Z? (see the attached picture)

A: Transcription is the process of synthesis of mRNA from DNA. The DNA strand which acts as the…

Q: Discuss how the bigger mRNA leads to creation of a smaller polypeptide?

A: For protein synthesis, the first step in transcription. In transcription, the information from DNA…

Q: How is it that females and males make different MRNAS?

A: The ribonucleotide mRNA, or informational RNA, is generated straight from the DNA molecule within…

Q: How to know the sequence of all mRNAs ?

A: For the determination of the gene sequence that is based on the template of mRNA, we need to do the…

Q: What is alternative splicing of pre-mRNAs?

A: When a single pre- mRNA is spliced in more than one way to produce two or more than two mature…

Q: • How does a repressor inhibit the synthesis of a specific mRNA?

A: The process by which mRNA is formed from a specific sequence in a gene is called transcription.…

Q: What is a polycistronic mRNA? How are polycistronic mRNAs formed?

A: Answer:Introduction: Polycistronic mRNA means messenger RNA means mRNA containing data  for the…

Q: Why is RNA editing important?

A: An mRNA stands for messenger ribonucleic acid (RNA). It is a type of RNA molecule. The major…

Q: How does the pre-MRNA transcript in the nucleus of a eukaryotic cell compare to the MRNA found in…

A: How does the pre-mRNA transcript in the nucleus of a eukaryotic cell compare to the mRNA found in…

Q: Is the shorter length of the mature mRNA a good thing or a bad thing?

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: What is the first anticodon recruited to an mRNA?

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: How is it that females and males make different mRNAs?

A: mRNA or messenger RNA is the ribonucleotide synthesized directly from the DNA molecule in the…

Q: How long is a guide RNA?

A: Ribonucleic acid (RNA) are polymeric organic molecules, which are essential for carrying out various…

Q: How mRNAs are often translated immediately and degraded ?

A: RNA is the short form for Ribonucleic acid, and it is an important biological macromolecule found in…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.