The role of the integral protein is to a) Create a barrier b) allow ions into the cell c) maintain fluidity at low temp d) recognize cell is safe
Q: The is morphological difference between bipolar neurons and unipolar neurons and that determines how…
A: As you are reading this book, think about the organs that are functioning within you right now! Your…
Q: Calculate ΔGinward. Is energy required for transport to happen? The cell is at 25°C. Membrane…
A: Energy is required in cases where there is active transport of molecules as molecules are…
Q: SCH₂ H OH H OH W W and Z X and Z X and Y W and Y NH₂ W and X =0 I CH₂ H OH X H H H NH₂ CH₂ OH OH Y…
A: The S phase, which is also known as the synthesis phase, is the phase of the cell cycle that…
Q: A. Let us see if you can help Draky, who traveled from home to his work using bicycle, but has been…
A: Given, Blood group of mother = O Blood group of father = A
Q: State 3 important results of meiosis.
A: Dividing phase of a cell cycle is the phase of actual division. ON the basis of cell type in which…
Q: Bob says that he is healthy and has no genetic diseases such as hemophilia or down syndrome.…
A: Genetics is the branch of Biology which deals with the study of genes and heredity. Haemophilia or…
Q: 4. What are some of the limitations of karyotyping? 5. Define trisomy. Define monosomy. 6. Define…
A: Genetics involves inheritance, characteristics, DNA, genes, proteins, and chromosomes. Everyone…
Q: If a polymorphism is found at a low frequency globally, but has a high frequency in a particular…
A: Polymorphism:- it represents the two or more than two variants of a particular DNA sequences or gene…
Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…
A: The cell Membrane or Plasma membrane is an external cell layer that acts as a selective barrier as…
Q: Why are basic dyes more effective for staining bacteria than acidic dyes
A: Answer: Dyes are the colouring component which are used for many purposes like in microbiology for…
Q: Is there a difference if one transfers 1 ml using a micropipette as opposed to pipetting 1ml using a…
A: Micropipette It is generally used for transferring small quantities of liquid in microlitres down…
Q: Which word best describes the image illustrated? P m tetrad staphylococcus Opalisades…
A: Bacteria They are prokaryotic unicellular organism which may be beneficial or harmful to human being…
Q: Where would you expect competitive exclusion to occur most quickly? (Choose the one best answer.)…
A:
Q: What anatomical feature in digestive cells allows more digestion? a. Goblet cells b. More nerve…
A: Digestion is a process involving the breakdown and metabolising of food particles to obtain…
Q: Describe the fluid compartments (ICF, ECF, blood and interstitial fluid) Describe the distribution…
A:
Q: a) Use this data, and sketch a graph by hand that would best fit the data. (think which type of…
A: Aurelia Aurelia commonly known as jellyfish because of its jelly like materials from which it is…
Q: How do you determine the polarity of a molecule?
A: Electronegativity is defined as the ability of molecules/compounds to attract electrons. Every atom…
Q: asap please.
A: Biosensor Biosensor are a analytical tool or device which is used for detecting chemical that is…
Q: Cells form the tissues found in the human body. The four primary tissue types combine to form all…
A: The cells are the smallest structural and functional unit of the body. The group of cells that…
Q: Where would you expect competitive exclusion to occur most quickly? (Choose the one best answer.)…
A: Competitive exclusion is one of the most important interactions in an ecological system where two…
Q: Whay does level 2 in Biosafety Cabinet Lever 2 mean? Why is it importnat to do the experiment in…
A: Introduction: The term biosafety cabinet, sometimes known as a biological safety cabinet, or…
Q: This specialized channel proteins facilitates water transport through osmosis. Spectrins Aquaporins…
A: In facilitated diffusion, the movement of solutes happens via transport proteins that span the…
Q: Match the following: Gastrulation Organogenesis Blastula formation Formation of organs Gamete…
A: INTRODUCTION Gastrulation is a process in the early development of the embryo. The gastrula is…
Q: A type of cell transport wherein large particles such as food and bacteria are engulfed through…
A: The term endocytosis was coined by Christian de Duve in the year 1963. Endocytosis is a process…
Q: Which of the following F2 phenotypic ratios show codominance? Assume you are starting with a…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Suppose the prevalence of HIV is 0.3% in the population of 500,000 blood donors for your…
A: Below I am attaching a image pls go through it.
Q: Parathyroid hormone and calcitonin are hormones that work antagonistically. Two other hormones that…
A: Introduction : Chemicals called hormones serve as the body's primary messengers. The endocrine…
Q: What method of application is most appropriate for the bio fertilizer and bio pesticide ?
A: Biofertilizers and biopesticides are living organism-based formulations which help in providing…
Q: Part of post a development of the genetically engineered foods (genetically modified organism or…
A: Although the methods to create a GMO plant are intricate, they generally go as follows: When a…
Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…
A: The cell is the primary and fundamental unit of life and each living organism is made up of a cell…
Q: what is the decimal reduction time?
A: D-value or the Decimal reduction rate is the required time to achieve 90% killing/ reduction of…
Q: The basic unit of the following is a nucleotide: a. DNA b. RNA c. ATP d. A and B e. All of the Above
A: Introduction :- A nucleobase, a five-carbon sugar (ribose or deoxyribose), and a phosphate group…
Q: Which of these processes are catalyzed by ribozymes? (Select all that apply.) DNA synthesis…
A: A ribozyme is defined as a ribonucleic acid enzyme that is required to catalyse a chemical reaction.…
Q: Which of the following are TRUE statements? Select all that apply The unfolding of a protein by heat…
A: INTRODUCTION Protein Proteins are biomolecules composed of amino acids.
Q: Write a note on fat soluble vitamins
A: Introduction A vitamin is an organic substance that is required in trace levels for good nutrition…
Q: What is the importances of Nucleic Acids?
A: Nucleic acid was discovered by Swiss physician Friedrich Miescher in 1868 from the nuclei of white…
Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU
A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…
Q: Pasteur used an S-necked flasks to disprove spontaneous generation. Explain the experiments that…
A: Spontaneous generation is a hypothesised theory that attempted to explain the origin of life…
Q: B-lymphocytes convert into plasma cells, before they produce antibodies. Which of the following…
A: phagocytes, a type of living cell, devour or engulf other cells or particles through a process known…
Q: Which of the following statements describes the function of plasma membranes? I. define boundaries…
A: Plasma membrane is a microscopic membrane of lipids and proteins which forms the external boundary…
Q: Address the general properties of the chromatin within the following types of DNA: DNA undergoing…
A: Introduction : Chromatin is a complex of macromolecules found in cells, consisting of DNA, protien,…
Q: Identify a false statement moist environment promotes bacteria colonization within our body O…
A: Bacteria Bacteria are classified under the kingdom Monera , they are prokaryotic cells. In bacteria,…
Q: High levels of calcium ions in the blood cause increased secretion of calcitonin and increased…
A: Hormones are chemical messenger of our body which controls our body activities and hormones are made…
Q: QUESTION 9 What is the genetic phenomenon when a person has a specific genotype but phenotypically…
A: In order to create a phenotypic outcome that cannot be expressed by a sigle gene attributed to the…
Q: Describe critical concentration (Cc) • Describe actin/microtubule polymerization • Contrast “T” and…
A: Cytoskeleton is complex network made up of microtubules, intermediate filaments and actin filaments.…
Q: Does the removal of Chthamalus affect the distribution of Balanus? O Yes No
A: Connell conducted a number of trials in which he moved the barnacles to various depths in the…
Q: Which of the following statements is true about linkage disequilibrium?
A: LD or linkage disequilibrium is the non-random association of alleles from different loci. LE or…
Q: B. There is another way to represent inheritance and that is using a Pedigree Chart to see how the…
A: Haemophilia is a disorder in which blood cannot clot after external or internal injury. Sometimes…
Q: Which of the following statements is TRUE about phospholipids? The hydrophobic fatty acid tails on…
A: Phospholipids are amphiphilic molecules with hydrophobic fatty acid chains and hydrophilic moieties.
Q: Wing Length for Ground Finches Observed in the Wet Seasons of 1973 and 1978 Wet 1973: all finches #…
A: The changes in finches beak size and wing length size are due to their adaptation in different…
Step by step
Solved in 2 steps
- . Many viruses enter host cells through receptormediated endocytosis. What is an advantage of thisentry strategy?a. The virus directly enters the cytoplasm of the cell.b. The virus is protected from recognition by whiteblood cells.c. The virus only enters its target host cell type.d. The virus can directly inject its genome into thecell’s nucleus.A microbe that is completely dependent on host cells for processes like transcription and translation” would describe which of the following? Select one: a. An intracellular protist parasite. b. A virus. c. A commensal bacterium. d. An intracellular bacterial pathogen. poiling yourself, you decide to eat at a fancy fish restaurant. One type of fish must be prepared carefully to remove a toxin that can cause paralysis. What type of channel is the toxin likely to affect? Select one: a. Voltage. b. Terminal. c. Mechanical. d. Positive.What cell types would be able to grow on the ECM in the following situations?a) Streptomycin was not added to the ECM.b) The ECM contains thiamine.c) The ECM contains all 20 amino acids and all 5 nitrogenous nucleic acid bases. Reminder: ECM = minimal medium + glucose + has streptomycin antibiotic
- What is the name of the phenomenon in which a white blood cell engulfs a pathogen? Which cytoskeletal structures are involved in this process? a. phagocytosis and microtubules. b.phagocytosis and microfilaments. c. pinocytosis and microtubules d. d. pincytosis and microfilamentsWhich of the following are binding/architectural proteins in the nucleus? a) U1 and U3 and H1, H2, and H3 b) cohesion, TFIIIC, CTCFCells need to be attached to a basement membrane in order to divide. What property of cells is described? A. Anchorage-dependence B. Density-dependence C. Growth factor dependence
- Which of the following is NOT a function of membrane-embedded proteins?Choose one:A. Membrane-embedded proteins can form the base of structures that extend out of the cell (such as flagella and pili).B. Membrane-embedded proteins can store important inheritable information that is needed by the cell.C. Membrane-embedded proteins can serve as receptors that detect specific environmental conditions.D. Membrane-embedded proteins can import or export specific molecules through the membrane.Microtubules (a) have constant diameters, but vary in length (b) vary in diameter, but are constant in length (c) vary in both length and diameter (d) are constant in both length and diameterWhat cell process does this statement describe? Waste material is enveloped inside a vesicle, and the vesicle merges with the cell membrane and releases the waste outside the cell. a. Phagocytosis b. Endocytosis c. Exocytosis
- Which of the following types of transporters would be utilized to move two different types of molecules across the cell membrane in the same direction? a. Uniporter b. Symporter/Cotransporter c. Antiporter d. Chemiporter e. ProtoporterChoose between osomosis, active transport, facilitated diffusion, simple diffusion, endo-exo cytosine . -Na+ high concentration outside, low inside. Cell wants it to go out. -Na+ high concentration outside, low inside. Cell wants it to come in. -O2 high concentration outside, low inside. Cell wants it to come in. -Put cell in salt water and it shrivels -Requires clathrin or similar molecule.Why is it important that the cell filters what comes in and out of it?