Lasers can be used in nanobiosensing: O Lasers are dangerous and should never be used inside a living human body When their power is very high O Mostly when their power is low enough to avoid photo-damaging O Only green lasers are approved for biomedical applications

Lasers can be used in nanobiosensing: O Lasers are dangerous and should never be used inside a living human body When their power is very high O Mostly when their power is low enough to avoid photo-damaging O Only green lasers are approved for biomedical applications

Biomedical Instrumentation Systems

1st Edition

ISBN:9781133478294

Author:Chatterjee

Publisher:Chatterjee

Chapter24: New Technologies And Advances In Medical Instrumentation

Section: Chapter Questions

Problem 1RT

See similar textbooks

Related questions

Q: 6. Explain how buffer systems are important in organisms. In the human body, bicarbonate and…

A: pH homeostasis is critical because some enzymes cannot operate if the pH varies from what it should…

Q: Being able to repair old cells, build new cells and structures like the mitochondria you need energy…

A: Introduction Any organic, living system that performs as a single entity is referred to as an…

Q: Which species is/are allopatric with E. lucunter?

A: The mechanism through which populations develop into different species is known as speciation. In…

Q: Branch, clade and monophyletic group are perfectly synonymous. Select one: True or False

A: Introduction : A phylogenetic tree is a visual representation of the evolutionary connections…

Q: INSTRUCTIONS: Please do not copy here in Bartleby or in Google. QUESTIONS : 1. Why is it importance…

A: Explain;- It is important to use the lid of the petri dish as a shield when streaking the plate…

Q: A certain plant species has dominant red flower color (R) to the recessive white flower color (r). A…

A: Introduction Inheritance is the process of transmitting traits from parent to offspring. The traits…

Q: para athway membrane capacitance Ach receptor channel conductance end plate current membrane…

A: The end plate is a bilayer of the cartilage and bone that separates the intervertebral discs from…

Q: Compare and contrast the structure and function on ribosomes and proteasomes.

A: Ribosome * Ribosomes are one of the cell organelles present in the cell * In eukaryotes and…

Q: Explain the three stages of cell signaling. a. receptor b. transduction c. response. Attach images

A: Introduction:- Cell signalling is a very important function of a cell because it allows a cell to…

Q: Protein and amino acids are not the preferred source of energy in the body since proteins are used…

A: Proteins are biomolecules composed of amino acids. Carbohydrates, proteins, lipids and nucleic acids…

Q: You have aseptically inoculated an unknown organism on a blood agar plate. You return 48 hours later…

A: The unknown organism on a blood Agar plate would cause hemolysis which is the destruction of red…

Q: Codons 24 to 66 represent an intron. At what point in the process of protein synthesis are introns…

A: Transcribing DNA to RNA is the initial step in a long process that finally synthesizes functional…

Q: Write only the class that exhibits the following characteristics

A: All marine creatures perform critical roles in their ecology. Plankton, on the other hand,…

Q: Almost all birds starved during the dry season depicted here. What type of selection would have been…

A: Due to different selective environment pressure, the gene pool composition changes, and this is…

Q: List the Five Kingdoms and give the distinguishing features of each kingdom, which ones are…

A: The living organisms are classified into different kingdoms based on there characteristics.…

Q: why is fluid mosaoc model called "fluid mosaic model" ?

A: Introduction :- Different facts on the composition of functional cell membranes are explained by the…

Q: Which exposure pathway has the fastest uptake in the human body?

A: There are various types of exposure routes by which agents can enter inside the human body. Some of…

Q: Which of the following most likely has a sequence of hydrophobic amino acids that permits the…

A: Correct answer: (a) Translocator (TIM/TOM) The transport of proteins inside the mitochondrial…

Q: Daisy inherits a mutation from her mother that results in the phenotype of red hair. Evegny acquires…

A: Introduction:- The DNA sequence varies from creature to organism. The order of the base pairs can…

Q: If a yellow pigment was present in the extract, as indicated in the chromatogram and its absorption…

A: Pigments are the coloured substances found in plants. Pigments help in photosynthesis and give a…

Q: If the DNA was replicated using the dispersive model, what would you have expected to observe in the…

A: 3 theories for DNA replication Conservative: According to this theory, the parent molecule is re…

Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…

A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…

Q: Multiple outgroups confuse the process of polarising characters. Select one: True or False

A: The outgroup is defined as organisms that are far distantly separated from another group of…

Q: E. Aureliano has a mutation in the blue-shaded nucleotide in the TEMPLATE DNA sequence. Instead of a…

A: A mutation is a change in our DNA sequence that happens as a result of errors in DNA copying or…

Q: If you wanted PCR to be successful but only had access to a thermolabile DNA polymerase, what would…

A: PCR - Polymerase chain reaction, is a process where DNA copies are amplified by a cyclic chain…

Q: what processes are most likely occurring during lag phase, growth phase (i.e., nucleation,…

A: Microfilaments are composed mainly of actin protein filaments and are essential to the eukaryotic…

Q: If you worked backward, starting with the amino acid sequence of the protein, would you obtain the…

A: The fundamental tenet of molecular biology is the idea that genetic material can only move from DNA…

Q: What are some other prezygotic reproductive barriers besides a mating dance?

A: Reproductive isolation is necessary for organisms to separate from their shared ancestors and propel…

Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU

A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…

Q: What is the purpose of each reagent in gram-staining? Primary stain Mordant Decolorizing agent…

A: Christian Gram devised this approach to discriminate between two kinds of bacteria based on their…

Q: Sickle cell anemia affects red blood cells by causing them to delivered efficiently to all parts of…

A: Red blood cells are present in the plasma of blood. The blood is a specialised connective tissue. It…

Q: The mouth is part of our digestive system. It would make sense then, that we would have more of the…

A: Cells are dynamic in the sense that they employ energy to accomplish a range of cell tasks such as…

Q: If the goose with genotype aa had migrated to population 2 as shown but had failed to mate with any…

A: The transfer of genes into or out of a population is referred to as gene flow. This migration could…

Q: Do the Paramecium show any signs of being electrically charged? If so, do they carry a positive or a…

A: Paramecium:- this organism belongs to eukaryotes having true nucleus. This is an unicellular,…

Q: Which of the following statements reflect the difference between RNA and DNA? Multiple answers:…

A: Introduction The process through which a gene's information is used to create a functioning gene…

Q: If two different organisms are closely related evolutionarily, then they will (a) be similar in…

A: Any accumulated or cumulative change in an organism's or population's features over a long period of…

Q: Which is made in the reproductive organs?

A: Reproduction is the process by which new individual organisms are produced. Organisms of the same…

Q: Which of the following is a primary function of the active site of an enzyme? a. It binds…

A: Enzymes are proteins that help speed up metabolism, or the chemical reactions in our bodies. They…

Q: What are the advantages of using the CORYNEX® protein expression system as compared to the commonly…

A: Protein expression systems are specifically designed systems for the purposely production of desired…

Q: What is a wet mount technique in microscopy?

A: Microscopy is the technical field of using microscopes to view samples and objects that the naked…

Q: A researcher who has pioneered cell-free fetal DNA testing to detect trisomies has received threats…

A: The assessment of changes in gene sequences in protein or DNA is known as genetic screening.…

Q: Genetically modified foods are products produced from organisms that have had genetic modifications…

A: Genetically modified foods are produced by genetic engineering techniques. Scientists modify their…

Q: Fill in the 3rd row of the Prediction Table. You should also be able to fill in the 4th row. Because…

A: Osmosis maintains cell turgidity. It is the process by which plants maintain their water content in…

Q: In allosteric activation_ O the substrate only binds to the low affinity enzyme. the effector binds…

A: Allosteric In enzymes whenever a molecule other than substrate bind it other than active site than…

Q: Discuss the effects of isotonic, hypotonic, and hypertonic environments on red blood cells and plant…

A: Osmosis is the net movement of water across a semipermeable membrane.

Q: Use the information in the tables below to determine the most probable number of bacteria per 100 mL…

A: The Most Probable Number (MPN) method, which replicates liquid broth growth in ten-fold dilutions,…

Q: What is the systems that depend on vesicular transport

A: “Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Compare and contrast convergent evolution and evolution by common descent, and give an example of…

A: Evolution is the process by which heritable traits change over time. There are two main types of…

Q: In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash…

A: DNA is a genetic material in most of the organism. It is two stranded ladder like structure which…

Q: (c) As for the vectors to be used for cloning and expression, suggest two types of plasmids suitable…

A: Genetic engineering has the ability to enhance the flavor of meals, boost nutritious value, and even…

Concept explainers

Human Movement

Humans can move from one place to another through coordinated movements and postures. The movement produced by the human body due to the contraction of muscles and bending of bone joints is called human movement. Human movements are controlled by the nervous system. Hence, the human movement incorporates the use of muscles, ligaments, joints, and bones. Kinesiology is the field that deals with the study of human movements.

Question

asap please.

Lasers can be used in nanobiosensing:
O Lasers are dangerous and should never be used inside a living human body
When their power is very high
O Mostly when their power is low enough to avoid photo-damaging
O Only green lasers are approved for biomedical applications

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Nano-engineered materials make superior household products such as degreasers and stain removers; environmental sensors, air purifiers, and filters; antibacterial cleansers; and specialized paints and sealing products, such a self-cleaning house paints that resist dirt and marks. 3 benefits and 3 costs. Which do you think is more equitable in its impact? (benefit or cost) Why?
What are the disadvantages of nano-engineered materials in superior household products such as degreasers and stain removers; environmental sensors, air purifiers, and filters; antibacterial cleansers; and specialized paints and sealing products, such a self-cleaning house paints that resist dirt and marks?
Nanotechnology Devices can improve human health. But can they do harm or be abused? What regulations would allow for beneficial uses of nanorobots without allowing for harm?
Which of the following is used extensively in biochemicaland genetic work ?(a) Agaricus (b) Alternaria(c) Neurospora (d) Mucor Please try to break the solutions into as many steps as practically possible and the steps should come one by one and they should be short and crisp and plagiarism-free.
Provide: a. The names of five (5) personal care or cosmetic brands that have nanotech ingredients. b. The nanotech ingredient being used if available. If not, just mention the active ingredient which probably is a nanotech even if it is not mentioned in the article or label. c. The manufacturing company.
Can you explain why using bio printing is better than SLA and which materials would be best to use for Bio priting out of collagen, fibrin or silk.
Why is ultraviolet radiation only sufficient for the disinfection of surfaces or air, while x-rays can be used for sterilization? The wavelength of ultraviolet light do not possess sufficient energy to damage bacterial cells. Ultraviolet light has a relatively low degree of penetrability. Many cells have enzyme systems that are able to repair radiation-induced DNA damage. Ultraviolet light is capable of ionizing radiation only.
FRAP can be used to analyze living cells.a) Trueb) False
The human body has structures that could be considered the product of “unintelligent design” (i.e. they are not efficient). What are two of these features and any problems that might be associated based on this inefficiency. Explain a better way to build each feature.
Make a biological diagram using this picture which has 400 X Magnification. I also added an example of this, you could trace and draw. Follow these guidelines: Guidelines for proper drawings1. Use blank unlined paper and a sharp pencil. No pens and no colour.2. A TITLE is at the top of the page, is descriptive centered underlined printed ALL CAPS.3. Drawings/photographs should be large enough to show all parts without crowding. The greater the number of parts to be included, the larger the drawing/photograph should be. In general, drawings/photograph should be ½ to ¾ of a page in size.4. Keep the drawing to the left of the centre of the page.5. Observe your specimen carefully, noting all the details of the specimen.6. Draw only what you see, not what you think should be there.7. Drawings should be as simple as possible, with clean-cut lines showing what has been observed. Do not “sketch”.8. Do not shade. Use a stippling technique for darker areas.9. All labels should be in a column to…
Fluorescent proteins are a useful tool in the biomedical scientist's toolbox because, a.they can be detected by flow cytometry b.none of the above c.they can be used to tag and track proteins d.they can come in a variety of colors e.all of the above f.they can be combined with a variety of imaging methods
Nanotechnology can provide alternatives to early detection of cancer cells, drug delivery, and injectable vaccines that to this day rely on healthcare professionals to administer. What are the benefits and cost of it? Which do you think is more equitable in its impact? (benefit or cost) Why?