The type of DNA replication error illustrated in the diagram below is _______________________. Copy -G-G-G-G-G-G-G-No changeТemplate — c-С-с-с-с-с-с—Copy -G-G G-G-G-G-G-InsertionTemplate — C-С-с-с-с-с-С—Copy -G-G-G-G-G-G-DeletionTemplate-с-ҫ ҫ-с-с-с —C

Answered: The type of DNA replication error…

Science

Biology

The type of DNA replication error illustrated in the diagram below is _______________________

Basic Clinical Laboratory Techniques 6E

6th Edition

ISBN:9781133893943

Author:ESTRIDGE

Publisher:ESTRIDGE

Chapter3: Basic Hemostasis

Section3.6: D-dimers

Problem 1.1CS

See similar textbooks

Related questions

Q: The enzyme that removes the RNA primer from the Okazaki fragment is: A DNA ligase B DNA gyrase (c)…

A: The double standard DNA molecule is produced by the action of DNA volume range and the process…

Q: DNA molecules with compatible sticky ends can be joined together by Select an answer and submit. For…

A: dna is the genetic material . it is a polymer of nucleotides , which are formed by nitrogen base ,…

Q: The enzyme responsible for adding new nucleotides to a growing DNA chain during DNA replication is…

A: DNA is the nucleic acid that stores genetic information.

Q: Using the picture below, match each letter (A-E) to 5' or 3' DNA polymerase molecule Parental DNA…

A: As the options are not visible, we are answering the question based on the general principle of DNA…

Q: True or False Replication of genetic material means that the genetic material is recreated to make…

A: The transfer of information from DNA to proteins is a familiarly known fundamental process that…

Q: What is the difference between DNA proofreading and DNA repair? In 3-4 sentence

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. DNA used as…

Q: Which letter represents the following structures: (0.5X6) Okazaki fragment Replication fork Leading…

A: The given image is representing the process of DNA replication that occurs inside the cell before…

Q: Explain in details the conservative replication of DNA and the dispersive replication of DNA

A: DNA replication is a process that takes place in every biological cell. It involves coping and…

Q: Letter 'd' corresponds to 5' 5' 3' origin of replication. primer. O replication fork. O Okazaki…

A: The Central Dogma theory states that DNA makes RNA and RNA makes proteins. DNA replication is the…

Q: the semi-conservative DNA replication

A: DNA replication is a process that involves the formation of identical copies of DNA from the…

Q: utline the four broad classes of chemical damage to DNA.

A: Epigenetic mechanisms are described in detail. Multiple biological processes that affect epigenetic…

Q: Describe and diagram the DNA damage done by UV radiation on a single strand of DNA. Describe in at…

A: The DNA molecules that encode its genome in human cells DNA damage is subdivided into two types:…

Q: Primer needed to initiate DNA replication is A) DNA segment B) RNA segment C) DNA-RNA hybrid D)…

A: INTRODUCTION Primers are short segment of RNA which act as a starting point for DNA replication.

Q: Refer to the image and answer the questions. 1. Which among the two strands will have a continuous…

A: A replication fork is formed when double-stranded DNA molecules are separated into single strands…

Q: Fill in the blank spaces below with the most appropriate terms. The word bank is not provided. DNA…

A: During cell division DNA makes a copy of itself and this process is called DNA replication. In this…

Q: Build a plypeptide DNA: TAC-TCC-CGG-GTT-ACC-ACT

A: DNA is the genetic material of the organisms like humans. The DNA is transcribed into the RNA by the…

Q: Choose the best answer for following question Where is the checkpoint that assesses the DNA for…

A: The DNA damage checkpoints can be defined as the pause in the cell cycle that is induced in the…

Q: Identify and mark each of the following on the portion of DNA undergoing replication: replication…

Q: Which of the following enzymes is the principal replication enzyme in E. coli?a) DNA polymerase Ib)…

A: E. coli bacteria contains 5 different DNA polymerases: DNA Pol I DNA Pol II DNA Pol III DNA Pol IV,…

Q: List two specific examples of DNA damage and what causes it

A: Step 1 of 2:) DNA damage is caused by many things this damage can lead to mutations which can…

Q: Identify the solution component that contains the extracted DNA.

A: Ethanol precipitation method is generally used for DNA extraction.

Q: In the process of DNA replication, there are four important enzymes. Construct a table, provide what…

A: Replication is the process of copying and duplicating a molecule of DNA. It is often defined as a…

Q: True or False: Polymerases open the DNA and create the replication bubble while helicases run…

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around one…

Q: DNA polymerase replicates DNA producing a _______ strand.

A: Answer: DNA polymerase replicates DNA producing a new complementary strand. Explanation: Duplication…

Q: Why are enzymes needed in the process of the DNA replication

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: A total of 16 DNA molecules are produced by how many rounds of replication

A: Introduction Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: Define the following terms:a. A-DNAb. B-DNAc. Z-DNAd. cruciforme. palindrome

A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: What is the name of the process of rehybridization of melted DNA? replication denaturation annealing…

A: DNA hybridization is the process, in which two strands of the complementary DNA are joined to form…

Q: d recombinant fraction

A: Genetics can be defined as the branch of biology that is related to the study of genes, genetic…

Q: ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE

A: Above table is codon anti-codon table for translation of DNA code into protein sequence.

Q: DNA replication isa) Conservativeb) Non-conservativec) Semi-conservatived) None

A: Deoxyribonucleic acid (DNA) is a genetic material present in most of the living organisms. DNA…

Q: During the DNA replication, what is the cofactor for the DNA polymerase to stabilize incoming dNTP?…

A: DNA replication forms the basis of inheritance which is the fundamental process occurring in all…

Q: Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the…

A: Replication is the process of synthesis of new strands of DNA from the parental DNA molecule and it…

Q: Explain the definition of DNA replication and list general steps of Replication

A: DNA replication means when a double-stranded DNA molecule is copied to produce two identical DNA…

Q: what if a mutation resulted in the enzyme DNA polymerase III being non-functional? How would that…

A: The mutation is defined as the change in sequence of nucleotides in a gene. The mutation can either…

Q: In the process of DNA replication, there are four important enzymes. Construct a table, provide what…

A: DNA replication is semi conservative process involves process of producing two identical DNAs from…

Q: Produce the complimentary DNA strand that would be matched with the provided strand T--A C--G C --G…

A: A complementary strand of DNA is constructed based on base complementarity. Complementarity is…

Q: Using the following DNA sequence what would be the complementary DNA made during replication? TAC…

A: Complementary DNA is synthesized from a mature mRNA strand and it lacks both promoters and introns.…

Q: What is an example of a disease or a disorder that results from an error in DNA replication? What…

A: Errors in DNA replication is called as mutation. This results in the change in sequence of DNA which…

Q: AKS 5b: Which model accurately represents the semi-conservative nature of DNA replication? * AA AA…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Examine the diagram carefully, and then answer the question below. vii VII i V iv vii Which one of…

A: Q. Which one of the following gives the correct names for the protein above ? Answer - (C) Helicase…

Q: Differentiate between DNA Polymerase I and DNA Polymerase III

A: DNA polymerase is an enzyme that synthesizes DNA molecules from deoxyribonucleotides, the building…

Q: Click on your screen over the DNA polymerase III enzyme depicted on the lagging strand. Replication…

A: Introduction : DNA replication is the process through which daughter DNA is formed from parental…

Q: Single-stranded regions of DNA are attacked by nucleases in the cell, yet portions of DNA are in a…

A: DNA replication is the process of production of identical copies of the DNA sequences. It is…

Q: Match the lettered activities to the following enzymes. Remember that some enzymes have multiple…

A: DNA Polymerase III is an enzyme primarily involved with DNA replication in prokaryotes. In 1970, it…

Q: Give the DNA compliment to the following DNA strand. ATG UAC b. TAC GTG OMG

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: In the diagram below, identify the DNA by clicking on the correct highlighted portion. TACGGGCTA

A: J.D Watson and F.H.C.Crick (1935) proposed a double helix model of DNA molecule, this is the widely…

Q: DNA REPLICATION/REPAIR PROTEINS

A: DNA stands for deoxyribonucleic acid. DNA replication is a very important process in the life cycle…

Q: Describe the three results of the lack of success of DNA repair. What are the consequences of each?…

A: DNA repair disorders are caused by genes that are involved in DNA mutation detection, repair, etc.…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

The type of DNA replication error illustrated in the diagram below is _______________________.

Copy -G-G-G-G-G-G-G-
No change
Тemplate — c-С-с-с-с-с-с—
Copy -G-G G-G-G-G-G-
Insertion
Template — C-С-с-с-с-с-С—
Copy -G-G-G-G-G-G-
Deletion
Template
-с-ҫ ҫ-с-с-с —
C

Definition Definition Mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of itself. DNA molecules utilize a semiconservative method for replication. DNA replication is the most essential part of biological inheritance and is crucial for cell division during growth and repair of damaged tissues.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Strand 1: C-G-T-A-T-C-T-C-A-T-A-G-C-TStrand 2 : A-A-A-G-A-T-A-T-C-A-C-C-C-AStrand 3 : T-A-G-C-C-C-T-G-G-T-C-T-T-TStrand 4 : A-C-C-G-G-C-T-C-G-A-C-T-T-C How to Fill Out This Chart: Write the number of the strand you are using in the first column, and then write out thenucleotides from the strand of DNA you picked in the boxes moving down the chart. Now, line up the first three nucleotides of the DNA strand with the first three spaces for mRNA.Write the matching nucleotide on the mRNA strand. (Remember to use Uracil).**Leave the short ones blank, that’s just to show you codons. Once you have your mRNA completed, fill out the mRNA column. You have now transcribed the strand of DNA to mRNA, which can now leave the nucleus. Remember acodon is a sequence of three nucleotides. Draw a box around all the codons (or three in a row). These areimportant for looking at how that information is translated into amino acids or Translation. Think of it asthe language of nucleotides is being…
EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .
I-D-E-L-Y-S-Q-V-C-S-H-L-D-T-V-R The amino acid sequence above forms an alpha helix. Place the amino acids on the wheel given below. L1 represents Leu.
5'-AGA-ACT-AAA-CTA-TCG-CTT-CGT--3' mRNA: original protein: mutated mRNA: mutated protein:
HpaI --- 5' GTT - AAC 3'5' GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3' 3' CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5' Number of pieces of DNA____
3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:
Which of the following sequences is less favorable to find in a folded beta? Select one: a.I-V-A-I-G-P-L-A-V-F-Y b. G-A-L-V-F-C-V-I-L-L-P c. E-V-A-I-I-F-M-D-G-V-A d. A-V-G-I-L-P-L-A-V-F-Y e.A-A-V-L-L-A-I-G-L-M-W
Reading from left to right, what is the nucleotide sequence on the other strand of DNA in this section? C-C-G-T-A-T-A-C-A-T* A. C-C-G-T-A-T-A-C-A-T B. T-A-C-A-T-A-T-G-C-C C. A-A-T-G-C-G-C-A-C-G D. G-G-C-A-T-A-T-G-T-A
2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence:
UCA CAG AAA CUG How many amino acids does the mRNA strand above code for?
How many nucleotides would be necessary to code for 10 amino acids? Please help, I am lost!
Complementary DNA