Q: What is meant by a cell cycle checkpoint? -What is its importance? -How does a cell stop it's…
A: Cell cycle refers to the formation of cell from cell. It is quite a complex process that requires…
Q: The functions of almost all of the genes in the lambda genome were first explored using mutations.…
A: Lambda is a bacteriophage virus capable of infecting of bacteria. The mature virus particle consists…
Q: adolescence, the number of red blood cells _____ in _____. a. increases; both girls and boys b.…
A: Red blood cell production mainly occurs in the bone marrow. The main stimulant that helps in the…
Q: List the three events that occur during the process of photosynthesis. Explain the role of stomata…
A: Introduction Plants absorb water (H2O) and carbon dioxide (CO2) from the soil and atmosphere during…
Q: Determining age at death for sub-adults is achieved by looking at the degree of epiphyseal fusion in…
A: Fusion of different bones occurs at age (years): Humerus distal end : 13-16 Femur proximal end :…
Q: Which of the following could not be used a a host cell receptor for viral entry? a.) LPS on…
A: What is a host cell receptor for viral entry? Each host cell carries specific biomolecules, known as…
Q: Part C of the question
A: The coding region of the given sequence is 109 to 285 nucleotides and 455 to 567 nucleotides. These…
Q: How many ATP molecules are overall produced in Glycolysis? 3 ATP 5 ATP 4 ATP 2 ATP
A: Question : How many ATP molecules are overall produced in Glycolysis ? Answer : 4 ATP molecules
Q: Which of the following statements best characterizes genetic diversity in humans? 1.) There are far…
A: Introduction:- Biological diversity is defined as the various different types of life or living…
Q: What occurs during food digestion? Energy in large molecules is used to make ATP. Energy from ATP is…
A: Digestive system is the system in our body which help in digestion and absorption of food , it…
Q: Which of the following base sequences would be impossible to find on a DNA strand? A-T-A-T G-G-G-C…
A: The DNA consists of Adenine, Guanine, Thymine and Cytosine as nitrogenous bases.
Q: 1. DNA- CGTACGTCAGCG RNA-? Amino acid? 2. DNA- GACAGTCAGATT RNA? Amino acid? 3. DNA? RNA-…
A: 1. DNA : CGTACGTCAGCG RNA : GCAUGCAGUCGC Amino acid : Ala-Cys-Ser-Arg 2. DNA : GACAGTCAGATT RNA :…
Q: The fruit fly Drosophila melanogaster has about 2 x 10^8 base pairs of DNA per haploid genome, of…
A: Drosophila is a fruit fly, which has genetically 4 pairs of chromosomes in its genome. It is the…
Q: 4.08 2.54 H Note: E E 1.02 1.02 1.67 H = EXON = INTRON AE E 10.8 kbp 3.94 3.66 E = EcoRI site H =…
A: Autoradiography is a method that visualizes molecules or fragments of molecules that have been…
Q: 1a) Name the start codon and the three stop codons for translation. 1b) What amino acid is…
A: An mRNA codon is a triplet or triple-nucleotide sequence that codes for a certain amino acid during…
Q: In this activity, you will: 1. Observe life forms other than those you studied from Grades 3 through…
A: This activity is about different types of living beings. Living beings carry out various life…
Q: and horns, to a dragon from another true-breeding line with no forelimbs, no wings, and no horns.…
A: During sexual reproduction, during the meiosis phase, the DNA sequences that are near to one another…
Q: Drugs and other medicine uses the concept of signaling. Cite some drugs how they mimic natural…
A: There are a few important points : Receptors : They are chemically protein and glycoprotein which…
Q: Maple syrup urine disease may be due to an autosomal recessive mutation. Data indicate that the…
A: Given that, Maple syrup urine disease is autosomal recessive. The prevalence of this disease is…
Q: hich of the following is true regarding the way we define clades with characters? Select one: a.…
A: A phylogenetic tree is a diagram used to visualize evolutionary relationships between organisms. It…
Q: Why is TP53 called the Guardian of the genome?
A: Instructions for producing a protein known as tumour protein p53 are found in the TP53 gene (or…
Q: Explain why you chose A or B, etc. Provide a logical explanation defending your answer choice. Q1:…
A: The size of the island and its position is very much crucial for species richness. There are several…
Q: The amount of sodium in Bowman's capsule can be doubled by: O A. Doubling of glomerular hydrostatic…
A: Introduction The Bowman's capsule, a component of the nephron, creates a sack that resembles a cup…
Q: Myosin, a motor protein that interacts with actin to drive muscle movement, is bound to a phosphate…
A: Proteins are highly essential for the body to provide in maintaining structural and functional…
Q: The amount of sodium in Bowman's capsule is determined by: A. Intracellular [Na] OB. Extracellular…
A: At the level of Bowman's capsule, amount of sodium will be only determined by the extracellular…
Q: how the Dual-energy-X-ray absorptiometry(DXA) and hydrostatic weighting to estimate the percentage…
A: Dual-energy-X-ray absorptiometry (DXA) for measurement of fat. DXA determines not only the precise…
Q: In eukaryotes, fatty acids are stored as triglycerides in cells that have A) Golgi that store fatty…
A: In eukaryote, fatty acids are stored as triglycerides in cells with Golgi that store fatty acids.…
Q: The next several questions refer to the data given in this problem. You sample a population of…
A: The prevalence of a gene variant in a population is represented by the allele frequency. Alleles are…
Q: Urianalysis- Need help understanding what is happening?
A: Question : Urianalysis - Need help understanding what is happening ? Answer : Urianalysis is the…
Q: Some Traits in Garden Pea Plants In pea plants, the genes for seed shape, seed colour, and plant…
A: The method GREGOR MENDEL described as a cross to identify the hidden characters is known as a…
Q: Environments with low frequency and intensity of disturbance tend to have ________ species diversity…
A: Species diversity It is described as the variety of species that exist in an environment and their…
Q: What is an example of a measurement error statment for doing an experiment dealing with counting…
A: Colony-forming unit (CFU, cfu, or CFU) is a unit used in microbiology to measure the number of…
Q: What are the dissimilarities between polyalphabetic and monoalphabetic ciphers?
A: Forensic science is involved with the gathering and evaluation of physical evidence as well as other…
Q: 2. What general conclusions can you derive from the data as to the effect of soil enrichment on the:…
A: Introduction Soil enrichment is a fertiliser catalyst that increases the effectiveness of…
Q: In low to middle-income countries, the risks of disease from environmental factors are high for…
A: Low- and middle-income nations bear a disproportionately large portion of the burden of diseases…
Q: Predict how blood pH levels will change as a result of the kidney’s reabsorption or excretion of…
A: The buffer that maintains the pH of human blood involves carbonic acid (H2CO3), bicarbonate ion…
Q: secondary messengers can inhibit signals of other pathways. True False
A: Introduction Seconds messenger:secondary messenger are small molecules and ions that play a major…
Q: Describe the virulence factors of H. pylori that allow it to colonize the stomach and survive…
A: Gastritis is a stomach lining inflammation produced by damage to the mucosal layer to prevent the…
Q: What would happen in the directionality of that activity were reversed? Would proofreading work? If…
A: Despite the remarkable accuracy of DNA replication, errors can occasionally happen, such as when a…
Q: Discuss the differences between saturated fatty acids, cis unsaturated fatty acids, and trans fatty…
A: Fatty acids contains a carboxylic acid with an aliphatic chain that may be saturated or unsaturated.…
Q: Explain the difference between an ecosystem and a habitat. Why are some microbial habitats…
A: Introduction: Our biosphere exhibits enormous diversity at all levels of biological structure, from…
Q: What occurs during food digestion? O Energy in large molecules is used to make ATP. O Energy from…
A: The process through which the food we eat moves through our bodies for the formation of new cellular…
Q: What occurs during food digestion? Energy in large molecules is used to make ATP. Energy from ATP is…
A:
Q: Please explain the difference between complete androgen insensitivity and pe-nis at 12 syndrome.…
A: An uncommon genetic condition of sexual development is known as androgen insensitivity syndrome…
Q: Explain why it is of prime importance to analyze water supplies that serve industrialized…
A: Water pollution occurs when contaminants produced by people pollute streams, rivers, lakes, oceans,…
Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…
A: Introduction The process by which a gene's information is used to produce either RNA molecules that…
Q: WHEN do you think apoptosis occurs in humans? - What would be the effect if apoptosis doesn't…
A: ANSWER) Apoptosis is described as the natural programmed cell death occuring in the multicellular…
Q: Explain what a competitive antagonist is using a named example. In your answer, explain why a…
A: When the agonist cannot bind to the active receptor in the presence of the competitive antagonist,…
Q: 6.c. Mutated DNA Template Strand #3: 3'-TACTGAC TGACTATC-5' Complementary DNA sequence: mRNA…
A: The mutation is the change in the base sequence of the DNA nucleotide sequence or a gene. The…
Q: Explain what is meant by the concept of "central dogma of molecular biology". Name the main…
A: An explanation of the movement of genetic information within a biological system is the core tenet…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Question 12What do seedless vascular plants have in common?QUESTION 11 Imagine a scenario where you decide to open a winery. The summer is not optimal for grape growing and you're searching in your memory for something regarding plant hormones. Explain 2 ways you could utilize plant hormones to compensate for a problem during growing (you can pick any kind of non optimal growing condition and explain how manipulating hormone levels could potentially help your grape babies).QUESTION 8 A plant responds to an aphid attack by activating a pathway that seals the phloem, cutting off the aphid’s supply of sap. This is an example of a constitutive/passive chemical defense a constitutive/passive physical defense an induced/active chemical defense an inducible/active physical defense
- please help to answer this question in one full paragraph at least 8-9 sentences. for each life cycle gymnosperms and angiosperms In one paragraph for each describe the life cycles of gymnosperms and angiosperms. Thank youQuestion:- Which of the following is FALSE about fruit? A. Mature ovary B. Protect seeds and aid in dispersal C. Exposes the seeds D. Produced by flowering plantsI need help with the structure of the Eastern Hemlock Leaf In the lab, we did a sketch of an eastern hemlock leaf and I need help labeling what structures are to the leaf.
- Question 1 1.4. The epidermis of all aerial organs such as leaves, stems, floral parts and fruits are typically provided with specialized openings called ….. A. pores. B. stomata. C. cuticle. D. glandular hairs. E. lithocysts. 1.5. Which type of primary tissue gives rise to primary vascular tissues? A. Protoderm. B. Procambium. C. Ground meristem. D. Shoot apical meristem. E. Root apical meristem. Question 2 Compare the parenchyma tissue to sclerenchyma tissue with regard to: a. the structure and composition of the cell wall b. functions c. position in plants [10]37 Wollemia nobilis, family Araucariaceae, phylum Coniferophyta, was discoveredrecently in a National Park in New South Wales, Australia. This stand of trees isremote and difficult to access. These trees can grow to 40 meters tall. Sadly, thisstand of trees has been infected with Phytophthora cinnamomi. An extensivebreeding program was undertaken and now this beautiful and ancient tree is readilyavailable for purchase. The common name for this tree is the Wollemi Pine.Answer the following questions in sentence format, that are related to the abovecase study.b. What reproductive structures does this plant have?37 Wollemia nobilis, family Araucariaceae, phylum Coniferophyta, was discoveredrecently in a National Park in New South Wales, Australia. This stand of trees isremote and difficult to access. These trees can grow to 40 meters tall. Sadly, thisstand of trees has been infected with Phytophthora cinnamomi. An extensivebreeding program was undertaken and now this beautiful and ancient tree is readilyavailable for purchase. The common name for this tree is the Wollemi Pine.Answer the following questions in sentence format, that are related to the abovecase study. a. What is the dominant generatiopn of life of this plant?
- QUESTION 36 In tropical rainforests, vegetation layers are structured according to ____. a. the plants’ needs for sunlight b. nutrient availability and uptake by plant roots c. how well each plant handles predation by herbivores d. sensitivity to temperature changes e. how deep the rainfall penetrates into the forestI have a question and I need it to be detailed | "Why do fruits Go brown?" Thank you.38. Which statement about stems is true? a. Gymnosperms have herbaceous stems. b. Woody stems produce xylem and phloem only once during the life of a plant. C. The vascular bundles are arranged in a circle in herbaceous monocot stems. d. Stems connect the vascular tissue from shoot to root
