Which of the following is FALSE about fruit? A. Mature ovary B. Protect seeds and aid in dispersal C. Exposes the seeds D. Produced by flowering plants

Q: what is the reason for an individual to have fasting high HDL levels. list and explain reasons.…

A: Introduction:- HDL ( High Density Lipoproteins) is an essential and good form of the cholestrol…

Q: Which of the following is a tropic (stimulating) hormone? Group of answer choices Thyroxine…

A: Tropic hormones are the hormones that are produced by anterior pituitary. They helps to stimulate…

Q: You finally received the gene sequence of a novel bacterial isolate. The supervisor required you to…

A: Bioinformatics is the study and use of biological information's complexities. Bioinformatics…

Q: Which is the most important digestive enzyme in gastric juice

A: The most important digestive enzyme in gastric juice is pepsin. Gastric juice is formed in the…

Q: Word Bank 2 Acetyl-CoA 2 ATP 2 ATP 34 ATP 2-€02 4 CO₂ Electron transport chain 2 FADH₂ Fermentation…

A: Introduction  A sequence of chemical processes known as cellular respiration convert glucose into…

Q: DNAT  A  C         C  G  C      C  C  C        A  T  G      A  T  G       A  A  T       A  C  C…

A: DNA sequencing is the process of determining the sequence of nucleic acids, which are the basic…

Q: Discuss briefly strategies employed by bacteria to develop resistance to antibiotics. Cite one…

A: Antibiotic resistance mechanisms include natural resistance brought on by an impermeable membrane or…

Q: Species that have undergone higher rates of change (long-branched taxa) tend to be linked…

A: LBA (long branch attraction) is a type of error wherein the distinctly related species are shown as…

Q: Besides plants, animals could also be genetically engineered. Describe TWO (2) transgenic fishes…

A: Transgenic animals are animals that carry a foreign gene. These genes are deliberately introduced…

Q: Macmillan Learning Hominin is a group of species that includes modern humans and extinct human-like…

A: INTRODUCTION Primates : primates are mammal group including monkeys, apes and human.

Q: BasH II Kpnl Dra TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT…

A: Many people agree that one of the 20th century's most significant contributions to molecular biology…

Q: Read all the parts of this question before answering. Thermogenesis is a metabolic process used to…

A: The generation of ATP depends on the generation of electrochemical gradient in electron transport…

Q: There are different type of fixatives, classify those fixatives based on its COMPOSITION and ACTION…

A: Fixatives are the physical agents or chemical substances which are used to stabilize or preserve the…

Q: For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid…

A: The given mRNA sequence: AUG ACU AGC UGG GGG UAU UAC UUU UAG  The corresponding DNA sequence will be…

Q: DNAT  A  C        C  G  C     T  C  C       G  C  C       G  T  C       G  A  C      A  A  T…

A: The self-replicating biomolecules  that are present in the chromosomes and carry genetic information…

Q: heightened responses to ethanol, and ken&barbie (kb) lack external genitalia. [These are real genes…

A: The technique of pinpointing a gene's position on a chromosome is known as gene mapping. The most…

Q: phospholipid that is destined to become part of the plasma membrane is synthesized inside a cell.…

A: There are some important points : Plasma membrane is a dynamic, fluid-structure and forms an…

Q: Which statement concerning vasopressin secretion is NOT true?  Group of answer choices Vasopressin…

A: Vasopressin It is also known as antidiuretic hormone, and it controls the circadian rhythm or the…

Q: The end of the chromosome in a prokaryotes A) is a telemore B) will get longer which each…

A: A prokaryotic chromosome is circular in structure. It is made up of circular DNA. Most prokaryotes…

Q: To maintain muscle mass, in-season training should rotate between  maximal strength and power…

A: Simply said, muscle mass refers to the total quantity of skeletal, smooth, and cardiac muscles in…

Q: If you analyze the leaf content of a cactus in the early morning hours, what do you expect to find?…

A: The metabolic pathway by which mainly the members of the family Crassulaceae assimilate carbon,…

Q: In a saliva of the patient the contents of enzymes is reduced. What cells of secretory portion do…

A: Salivary glands are made up of secretory units also known as acini and ducts. Ducts are highly…

Q: Drag each of the following events to the location where they occur in a eukaryotic cell Nucleus…

A: Introduction  The process through which a gene's information is used to produce either RNA molecules…

Q: Macmillan Learning An extensive study of a hominid fossil dating from approximately 2 million years…

A: The fossil record of hominids is one of the finest known and most comprehensive of any animal. This…

Q: arrived from the mainland 100 years (at least 50 generations) ago on been little or no gene flow…

A: Many of the hypothese regarding the genetics of adaptation require that one know specific details…

Q: B cells are most important in the _______ immunity type of _______ immunity.? .A.Cellular;…

A: We know that Immunity is resistance to disease. The two important components of immunity are innate…

Q: How will the CO2 concentration change in the field influence leaf photosynthesis measurements?

A: Metabolic process is a basically chemical reactions in which bigger molecules are formed/ destroyed…

Q: DNA profiling has been used to verify pedigrees of valuable animals such as show dogs, racing…

A: Eukaryotic genomes contain a significant amount of repetitive DNA that does not code for proteins. A…

Q: Genetically modified foods are products produced from organisms that have had genetic modifications…

A: Biological entities (plants, animals, or microorganisms) in which their genetic material (DNA)…

Q: 2. How would you determine if the two populations belong to the same species? What factors might…

A: Population is a group of individuals that belong to same species. Species contain organisms that…

Q: Adenine Cytosine Deoxyribose DNA DNA helicase DNA polymerase Double helix Lagging strand Leading…

A: DNA structure formation

Q: Search for genes involved in envelope components by searching the gene annotations and report how…

A: …

Q: When energy flows from one trophic level to the next, much of it is lost and does not make it up to…

A: In the ecosystem food chain and food web are present that gives the idea about the interaction…

Q: If glycolysis has an overall –DG (i.e., it’s exergonic), why does it require an energy investment of…

A: Glycolyis can be defined as a process in which one mole of glucose is converted into two moles of…

Q: Which of the following specifically explains why glucose uptake into intestinal cells happens in…

A: Active transport is selective and occurs against the concentration gradient. It is of two types…

Q: How do Southern blotting, Northern blotting and Western blotting

A: in genetically modified organism all above three specific separation technique are used for genes…

Q: In the following instance describes an experiment involving the effect of precipitation on the…

A: At low temperature the rate of photosynthesis is  limited  by the enzymes to carry out the process…

Q: Indentify the correct food web for each question. Which type of food web cycles materials and moves…

A: INTRODUCTION Food chain : it explains who eats whome in a wild. This helps to the flow of energy and…

Q: The postgraduate student, Jocelyn, transformed her gene of interest into two different vectors;…

A:

Q: HS IP: FLAG-KDM3A SIA - WT + Lane Number: 1 2 3 S/D 4 5 6 Stat1 FLAG

A: KDM3A phosphorylation after 30 or 60 minutes of heat shock at 42°C (heat shock (HS) is generally…

Q: 6) The figure that follows shows DNA fingerprint analysis of the genomic DNA from semen associated…

A: Creating an artificial gene is commonly referred to as DNA printing. There are several methods for…

Q: When Griffith injected mice with IIR strain mixed with heat-killed IIIS bacteria, A. The mice…

A: Griffith did his experiment in 1928. He did his experiment by taking mice and Salmonella bacteria.

Q: Are the invertebrates polyphyletic, monophyletic, or paraphyletic? (all organimsms shown are…

A: The construction of phyllogenetic tree helps us identifying the common ancestor of them.…

Q: Convert to cDNA and add linkers

A: This is the High-throughput sequencing that has become the  revolutionary technique for the…

Q: Explain the challenges that insects have to overcome to maintain ion and water balance. Describe the…

A: Any species' ability to regulate water and ion balance depends on various hormonal factors, each…

Q: Species A has 2 amino acids. minimum codon length: Species B has 7 amino acids. minimum codon…

A: Introduction :- The biggest group of organisms in which any two individuals of the right sexes or…

Q: Besides the pUC series, there are other plasmid vectors in the market such as pBR327 and pGEM-T.…

A: Cloning methods are used in biotechnology for various purposes. TA cloning is the technique that…

Q: Why does low biodiversity in an ecosystem tends to increase the proportion of ticks carrying Lyme…

A: Biodiversity is the variety of species existing on the earth. It reflects organization of organisms…

Q: .4 Indicate whether the following statements are true or false. For each FALSE answer please…

A: Introduction :  In order to absorb nutrients, complex food particles must be broken down into…

Q: pZERO®-1 is a 2808 bp cloning vector from Invitrogen. This vector allows effective selection of…

A: The PET sequences are simentensously traced to the genome assembly to define the boundaries of…

Angiosperm Reproduction

The process of sexual reproduction in flowering plants is known as angiosperm reproduction. In flowering plants, reproduction begins with pollination, or the transfer of male gametes (pollen) from the male reproductive organ (anther) to the female reproductive organ (pistil), and ends with fertilization of the female gametes (egg), which produces a zygote, which then grows to become a mature plant.