This exercise is will require you to write a C program that is able to run Linux commands from the program when executed. The program should be able to perform the following operations: 1. Take a Linux command as an input from the user using scanf in C. 2. This command should be a valid Linux command 3. The program should use execvp(char *command, char *params[]) function to run this Linux command and produce and output on the console. 4. The screenshot below shows the expected output of the program: Instructions: • Write the C program in any editor of your choice. • Use execvp(char *command, char *params[]) function to run the commands

This exercise is will require you to write a C program that is able to run Linux commands from the program when executed. The program should be able to perform the following operations: 1. Take a Linux command as an input from the user using scanf in C. 2. This command should be a valid Linux command 3. The program should use execvp(char command, char params[]) function to run this Linux command and produce and output on the console. 4. The screenshot below shows the expected output of the program: Instructions: • Write the C program in any editor of your choice. • Use execvp(char command, char params[]) function to run the commands

C++ for Engineers and Scientists

4th Edition

ISBN:9781133187844

Author:Bronson, Gary J.

Publisher:Bronson, Gary J.

Chapter8: I/o Streams And Data Files

Section8.4: File Streams As Function Arguments

Problem 1E

See similar textbooks

Similar questions

In this laboratory work, you are expected to write a c# console application to make someoperations about the customers. Operations and required featurest that you need to cover inyour program are following:• Add: This function adds a new person to json file. You need to get inputs from userand adds the new one into json file.• Display: This function displays all people in your json file.• Search: This function let you search with the user id.• Create Password: This function will create a random password for the user and usermay choose the length of the password. Password may include numbers andcharacters.• Exceptions: You need to handle exceptions as well. You should at least handle 3 ofexceptional cases. For the case that file can not be found, It is mandatory to catch theexception.
By using Linux (Centos 7 or 8) develop a C program to apply the memory times and times, run with this shellprogram, then show the MemToal,MemFree,Active with excel file. Here are the codes for reference. Code no.1: #include <stdio.h> #include <stdlib.h> #include <string.h> #include <unistd.h> main(int argc, char *argv[]) { void * p[100]; int i,times,msize; if(argc!=3) { times=20; msize=1024; } else { sscanf(argv[1],"%d",&times); sscanf(argv[2],"%d",&msize); if(msize>10240) msize=10240; msize=1024*msize; if(times>100) times=100; } for( i=0; i<times; i++) {…
You have written a C program which was stored in file someProgram.c, under directory /home/chloe/TestingCode; in that same directory, you have a sub-folder called Old. Answer the following questions (by typing the appropriate single command line instruction in each case), assuming you are currently in /home/chloe/TestingCode: Compile the code in someProgram.c. Create a new sub-folder called New under /home/chloe. Show the location (i.e., the full path) of the current directory. Make a copy of the file someProgram.c and call it someProgram_v2.c.
Modify this code to let it run concurrently to send and receive any messages between 2 processes and take one command line argument to change between 2 processes, for example, 1 or 2 to indicate the process 1 or process 2. #include <unistd.h>#include <stdlib.h>#include <stdio.h> #include <string.h>#include <fcntl.h>#include <sys/types.h>#include <sys/stat.h>#define FIFO_NAME “/tmp/my_ fo”int main(int argc, char *argv[]){int res, open_mode = 0; if (argc < 2){fprintf(stderr, “Usage: %s <[O_RDONLY, O_WRONLY, O_RDWR, O_NONBLOCK]>\n”, *argv); exit(EXIT_FAILURE);}argv++;if (*argv){if (strncmp(*argv, “O_RDONLY”, 8) == 0)open_mode |= O_RDONLY;if (strncmp(*argv, “O_WRONLY”, 8) == 0)open_mode |= O_WRONLY; if (strncmp(*argv, “O_RDWR”, 6) == 0) open_mode |= O_RDWR;if (strncmp(*argv, “O_NONBLOCK”, 10) == 0)open_mode |= O_NONBLOCK;} if (access(FIFO_NAME, F_OK) == -1{res = mk fo(FIFO_NAME, 0777);if (res){fprintf(stderr, “Could not create fo%s\n”,…
Utilize looping to make your Python script for Functionality 2 [You should allow users to enter information for five employees at the same time, where the first employee information entry is saved in index [0] and the second entry is saved in index [1], and so on. You want to make sure to enforce the user to enter the following employee information: employeeName, employeeSSN, employeePhone, employeeEmail, employeeSalary. After the user finishes entering the last employee information, they should get a message to allow them to print specific employee information from the saved list. The user can enter values between 1 and 5, where 1 will return the employee information saved in the list index [0], 2 will return the employee information saved in the list index [1] and so on.]to run constantly. while having it run constantly Add Employee – this functionality will allow users to add new employee to the system. View all Employees – this functionality will view all employees in the system.…
Utilize looping to make your Python script for Functionality 2 You should allow users to enter information for five employees at the same time, where the first employee information entry is saved in index [0] and the second entry is saved in index [1], and so on. You want to make sure to enforce the user to enter the following employee information: employeeName, employeeSSN, employeePhone, employeeEmail, employeeSalary. After the user finishes entering the last employee information, they should get a message to allow them to print specific employee information from the saved list. The user can enter values between 1 and 5, where 1 will return the employee information saved in the list index [0], 2 will return the employee information saved in the list index [1] and so on.]to run constantly. while having it run constantly Add Employee – this functionality will allow users to add new employee to the system. View all Employees – this functionality will view all employees in the system.…
C++ I need to make a program that reads lines of text from a file using the ifstream getline() method, tokenizes the lines into words ("tokens") using strtok(), and keeps statistics on the data in the file. Your input and output file names will be supplied to your program on the command line, which you will access using argc and argv[]. I am mostly confused on how to use argc and argv[] command line the text file contains: the quick brown fox jumps over the lazy dog. now is the time for all good men to come to the aid of their party. all i want for christmas is my two front teeth. the quick brown fox jumps over a lazy dog.
using c++ In this assignment you are going to implement your own version of university library system,Thesystem will have two different sides , the first one is to help the librarian to do his job and the other side for admin to manage every one permissions in the system , so You should provide the following features in your system: Admin view o Add/remove Studentso Add/remove librarian o Add/remove other admins Librarian viewo Add/Delete bookso Issue/Return bookso View bookso View Issued bookso Log in /log outo Search for the book(id/name) Simple backend for your system , You could use a file each row should represent itemo Books File should be something like:Id , Book Name, Author Name, Available quantity, Issued Quantity1,Oliver Twist, Charles Dickens,98,2In the previous the first row was the name of each column , you can do that or handle it in your code , id =1 , Book Name =Oliver Twist ..Etc. Tables neededo Books Id  Book Name Author Name Available quantity Issued…
In this final submission, you will build on checkpoint B to load the database and DNA sequence from files. There will be two databases and several sequences that will be available for download below. Example of the database is the file small.txt: name,AGATC,AATG,TATC Alice,2,8,3 Bob,4,1,5 Charlie,3,2,5 Example of the sequence is the file 1.txt: AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG Implement/modify the following functions: Modify the function readData, which will now take an additional parameter: a string representing the filename containing the database of individuals and their STR counts. It will also return a bool indicating if opening the file was successful or not: bool readData(string filename, vector<string>& nameSTRs, vector<string>& nameIndividuals, vector<vector<int>>& STRcounts) Update the function…
After working this code, this is the error code that popped up resulted in half right. Traceback (most recent call last): File "main.py", line 292, in <module> print(double_pennies(starting_pennies, user_days)) File "main.py", line 264, in double_pennies total_pennies = double_pennies((num_pennies * 2), (num_days - 1)) File "main.py", line 264, in double_pennies total_pennies = double_pennies((num_pennies * 2), (num_days - 1)) File "main.py", line 264, in double_pennies total_pennies = double_pennies((num_pennies * 2), (num_days - 1)) [Previous line repeated 995 more times] File "main.py", line 260, in double_pennies if num_days == 1: RecursionError: maximum recursion depth exceeded in comparison
In C++ please 1. Write a program reading input from the user. I do not particularly care how (via a file, or making them type something in, or a command line argument via argc/argv). What this program does is up to you, but it should use the memory management(delete and reallocate) AND exception handling(try, throw catch) features from the readings in the text. The program should have at least 500 lines of code, as measured by cloc, and it should only require standard C++ libraries, no unusual packages -- the code should compile and run as-is easily on Mac and linux platforms. 2. The program should do something interesting; again, what is really up to you, but you should be able to explain the purpose of the computation in a comment at the top! 3. You'll want to prepare a second version of the program that _is broken_. You should introduce _two distinct_ bugs into the program so that for some (but not all!) user inputs, the program does _not_ do what it should. This should be a matter…
What do you see when you execute "pipe1" and Why? Modify the program pipe1.cpp to pipe1a.cpp so that it accepts a command (e.g. "ls -l") from the keyboard. For example, when you execute "./pipe1a ps -auxw", it should give you the same output as pipe1.cpp. Please explain what you changed and why.(Hint: Use string functions strcpy() and strcat() to store the commands in a buffer. Your main function should be like: int main(int argc, char *argv[])) //pipe1.cpp #include <unistd.h> #include <stdlib.h> #include <string.h> #include <stdio.h> #include <iostream> using namespace std; int main() { FILE *fpi; //for reading a pipe char buffer[BUFSIZ+1]; //BUFSIZ defined in <stdio.h> int chars_read; memset (buffer, 0,sizeof(buffer)); //clear buffer fpi = popen ("ps -auxw", "r"); //pipe to command "ps -auxw" if (fpi != NULL) { //read data from pipe into buffer chars_read = fread(buffer, sizeof(char), BUFSIZ, fpi); if…