Q: Kevin and Sonia want to prepare a bean salad for the class picnic. They buy a package of dried…
A: Introduction: To soak beans the old-fashioned manner, cover them with 2 inches of water, 2 teaspoons…
Q: What is the only known effect of deficiencies in complement components C5–C9? Explain this effect.
A: Introduction: The innate humoral immune system relies heavily on the complement system. The…
Q: Imagine that you discover a new type of bacteria in an environment that is exposed to oxygen. A.…
A:
Q: Who originally deserved Kudos for genetic engineering
A: Genetic engineering, often known as genetic modification or genetic manipulation, is the use of…
Q: List Darwin's Postulates and show which ones are random and which ones are deterministic
A: Evolution Evolution is a continuous process involving change which occurs due to the adaption of new…
Q: The non-wild-type alleles are k (clipped wings), l (long tail), and m (magical powers). The parental…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: Arthritis diseases are due to: in the veins is lower than in the arteries. When a person stands…
A: Arthritis It is a common disorder in which the joints are affected. This condition causes pain and…
Q: 10 Which of the following would be a case of evolutionary migration (gene flow)? A. Warblers of a…
A:
Q: Which of the following describes cardiac muscle tissue? Select all that apply. a striated b…
A: Introduction Cardiac muscles, these types of muscle are found only in the walls of the heart. It is…
Q: 2. A learner carried out an experiment on water loss from leaves. The learner wanted to find out…
A: Introduction Leaf base, leaf lamina, and petiole are the three primary elements of a leaf. Simple…
Q: Q3.4. In one of the reactions in the electron transport chain, coenzyme Q (i.e., "Q") transfers…
A: The electron transport chain involves transportation of electrons through different membrane…
Q: What is the expected frequency of the restriction site 5′−GGCC−3′ in a genome? A. Once every 4…
A:
Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…
A: DNA is a double helical structure composed of two DNA strands.
Q: List processes Microorganisms are involved in (ex., oxygen production)
A: All the organisms which performs the process of Photosynthesis can produce oxygen. Microorganisms…
Q: 4. In humans the primary purpose of cellular respiration is A the removal of CO₂ from animal cells…
A: Introduction :- The metabolic pathway that breaks down glucose and produces ATP is known as cellular…
Q: The antibiotic erythromycin works by blocking ribosomal movement (translocation) along an mRNA, in…
A: Introduction: One of the most prevalent antibiotic mechanisms of action is translation inhibition,…
Q: Q2- The charge in nerve axon depending on-------inside axon, ----outside axon Na, K OK,Na k,CL
A: In neuron , Positively charged Na+ ion is pumped out and positively chared K+ ion is pumped…
Q: 7. is the high energy carrier that is regenerated during fermentation that allows cell to continue…
A: The process of breakdown of glucose to various intermediates and finally convert to pyruvate is…
Q: Write short notes on the reproductive strategies in the two main groups of eukaryotic…
A: Eukaryotic microorganisms do not reproduce solely through binary fission, as bacteria do; instead, a…
Q: Please compare the design and operation of a protein precipitation unit to that of a chromatography…
A: Protein precipitation is a process in which proteins are removed from solution by the addition of…
Q: If jaguar populations become isolated, would this be enough to classify them as subspecies?
A: Jaguar considered as keystone species that means, they are the apex predators which helps in keeping…
Q: Which structure is the male gametophyte? the microgametophyte the pollen grain O the megagametophyte…
A: Introduction : All plants and some algae species have a stage in their life cycle known as the…
Q: Biology homework questions I’ve been having trouble with. I need lots of help! 1. How many ATPS are…
A: Cellular respiration is a group metabolic process used by every living organism to produce energy in…
Q: Which of the sentences below does not describe an autotroph? a wheat that is used to make flour for…
A: Introduction An autotroph is an organism that is able to form nutritional organic substance from…
Q: Sequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which…
A: In our Desire primer it is 15 nucleotide long however on gels there are only 10 bands are present…
Q: Research the behaviours of a specific ectothermic animal. How do specific behaviours allow for the…
A: Ectothermic animals, also called cold-blooded animals, rely on external sources of heat to maintain…
Q: An organism has eight offspring and two die every year for four years. What type of survivorship…
A:
Q: To explain the mechansim of histocompatibility.
A: Innate defence and adaptive defence are two bodily processes that guard against pathogens. Innate…
Q: ITEM MSM MICROBIAL PROFILE MICROORGANISM/CAUSATIVE I AGENT A GRAM REACTION B OXYGEN REQUIREMENT C…
A:
Q: To explain the name of three antigen-presenting cells along with their other functions.
A: Innate defense and adaptive defense are two bodily processes that guard against pathogens. Innate…
Q: Identify the incorrect statement regarding NKT cells. (Select all that apply.) a. They express α:β…
A: NK cells play an important role in the innate immune response to primary infection, as well as…
Q: What has caused the population illustrated below to slow down? a consumption of resources b high…
A: The growth of the population depends on several factors. The factors affecting the population growth…
Q: What are the major ecosystems of the world? Describe forest and pond ecosystems in detail
A: Ecosystem A geographical area in which plants, animals, & other species, as well as weather…
Q: A transmembrane protein has the following properties: it has two binding sites, one for solute A and…
A: Introduction :- Transmembrane proteins (TP) are integral membrane proteins that traverse the entire…
Q: 1. Which sugar is a monosaccharide? a. Maltose b. Glucose c. Sucrose d. Lactose
A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…
Q: What causes the transfer of electrons through an electron transport chain? a. The initial "push"…
A: Introduction The electron transport chain is a collection of proteins and organic compounds located…
Q: can we modulate motor function to treat human disease?
A: Mechanisms of plasticity and metaplasticity have been demonstrated in basic scientific…
Q: Compare and contrast the immune reaction for: -pathogen, allergy, and autoimmunity. Talk about the…
A: Immunity is the complex cellular and molecular mechanism of the body to maintain healthy conditions…
Q: DNA replication involve parent and daughter DM
A: Catabolism is the set of metabolic pathways that breaks down molecules into smaller units that are…
Q: (Clumped) & (quadrat)
A: Dispersion is the term in ecology involves the movement of an individual or multiple individuals…
Q: The name of two major categories of vaccines and then the subcategories under each.
A: Introduction: A vaccine is a biological preparation that provides "active acquired immunity" for a…
Q: Write short notes on dry heat as a physical antimicrobial control method.
A: Drying can be used to control the growth of microorganisms because when water is removed from cells,…
Q: One industry that is in need of sustainable practices is the fishing industry. Which of the…
A: Fishing industry include the catching, processing, transportation, Distribution and Marketing of…
Q: What type of features do you feel should be used to classify humans as a species? please answer…
A: Modern taxonomic classification system has 8 main levels. Domain Kingdom Phylum…
Q: What is an example of a post translational modification? a. Poly (a) tail b. 5' capping c.…
A: Following protein production, covalent and typically enzymatic modifications to proteins are…
Q: 5. The products of glycolysis include A pyruvate . B. ATP C. NADH D A and B . E. A, B and C
A: The Glycolysis is a ten step enzymatic reaction where a six carbon containing sugar molecule is…
Q: What is the gene in the human chromosome that determines the "maleness"?
A: Gene is the sequence of nucleotides that encode a particular protein. The genes are present in the…
Q: How is our concept of human form and function today affected by inventors from the seventeenth to…
A: Introduction :- Humans are the most numerous and ubiquitous primate species, distinguished by…
Which of these variables is the BEST choice for transferring genes into a plant cell?
Step by step
Solved in 2 steps
- Whether the Alternaria brassicae genome sequencing completed?Agraobacterium mediated transformation is a useful gene transfer technique but still we can’t use Ti/ Ri plasmid directly as a vector. Why?Virology:For each letters below a, b, and c provide a one sentence description of the step in retrovirus replication the letters are indicating