Treating a cell with a drug to stop tRNA from doing its job would mean what? A. that ribosomes would fall apart B. that sugars would not be added to proteins C. that nothing would be available to translate D. that amino acids would not be brought to the growing protein

Treating a cell with a drug to stop tRNA from doing its job would mean what? A. that ribosomes would fall apart B. that sugars would not be added to proteins C. that nothing would be available to translate D. that amino acids would not be brought to the growing protein

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 14SA: Energy that drives translation is provided mainly by ______ . a. ATP c. GTP b. amino acids d....

See similar textbooks

Related questions

Q: What is the role of transcription in the determination of the amino acid sequence of a polypeptide…

A: Transcription is the initial stage in gene expression, when information from a gene is used to build…

Q: Evaluate the following statements. Which one statement is false?

A: Answer: Central Dogma : It is the complete process of replication , transcription and translation of…

Q: Explain why cell biologists predicted that the genetic code would be based on a 3-base codon.…

A: The genetic code is the precise sequence of DNA nucleotides read as three-letter words or codons…

Q: Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA

A: Translation is the process by which proteins are synthesized by joining of amino acid using mRNA and…

Q: Use your DNA strand to construct a part of a messenger RNA molecule. DNA A G T…

A: When DNA is converted into mRNA then this process is called transcription.Transcription occurs in…

Q: Draw a simple schematic of a tRNA molecule showing its two "business" ends.

A: t-RNA is a type of RNA molecule that is clover leaf like in structure. It is known as transfer RNA.

Q: As with all biomolecules, rRNA has a structure that directly relates to its function. Which…

A: Ribosomal RNA or rRNA is a ribozyme that catalyzes the synthesis of proteins. This non-coding RNA…

Q: How are rare bases incorporated into tRNAs? a. Encoded by guide RNAs b. By chemical changes to one…

A: RNA contains four types of nucleotides adenine, guanine, cytosine, and uracil. In addition to these…

Q: NA contains the information that a cell uses to synthesize a particular protein. How do proteins…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: In the chain elongation of proteins, the new aminoacyl-tRNA bonds to? a.A site b.E site c.G site…

A: Translation is process by which the cells produce protein from the information provided by the DNA.…

Q: Which would be worse for an organism? Briefly explain your answer. B. The spliceosome can no longer…

A: Cell is the basic and fundamental unit of life. Survibility of life depend upon individual cells…

Q: 44

A: The given structure is of tRNA molecule which is an adapter molecules for amino acid synthesis.

Q: Use the figure to answer the question. 5' tRNAS , which are single-stranded, have what is described…

A: Introduction :- t-rna (transfer RNA) which is used in translation i.e protien synthesis.Its…

Q: translate the following sequence of messenger RNA nucleotides in a sequence of amino acids forming…

A: Since you have posted a question with multi-sub parts, we will solve the first three sub-parts for…

Q: nfer what the result would be if the A site on the ribosome was not in the correct conformation…

A: The biochemical substance that is carried from the preceding generation to the succeeding generation…

Q: Where does the transcription of DNA into mRNA occur in eukaryotes? A. Nucleus B. tRNA C.…

A: The gene expression involves the transcription and translation of gene and mRNA (messenger…

Q: To facilitate movement of mRNA from the nucleus into the cytoplasm, what is added to the 3’ end of…

A: According to the question, we have to explain to facilitate the movement of mRNA from the nucleus…

Q: What is the genetic code? a. The relationship between a three-base codon sequence and an amino acid…

A: Translation is the process of conversion of an mRNA (messenger RNA) molecule into a functional…

Q: As with all biomolecules, rRNA has a structure that directly relates to its function. Which…

A: To determine: In all biomolecules, which describes the relationship between structure and function…

Q: The diagram below shows the result of a hybridization experiment between a eukaryotic mRNA and the…

A: The process of hybridization refers to the combination of two complementary single-stranded RNA or…

Q: If a sequence of bases on a DNA molecule is GATTACA, what would the complimentary mRNA strand look…

A: DNA replication is the process of the formation of identical copies of DNA.It occurs in nucleus.…

Q: A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Give

A: Introduction:- The central dogma of biological sciences explains how genetic information is…

Q: How is translation different in prokaryotes and eukaryotes? a. In prokaryotes, because they do not…

A: Translation is a process which takes place after transcription, in which the genetic information…

Q: During protein synthesis, one amino acid binds to RNA molecules. a) What is this RNA molecule? b)…

A: The process of formation of Amino acids from mRNA molecule is known as translation.

Q: Ribosomes contain catalytic ________ molecules.

A: Answer - Option C - rRNA

Q: Transfer RNA ____________________. a. Carries amino acids to the ribosome b. Carries information…

A: The RNA is a biopolymer and the existence of complementary sequences on the RNA strand ensures that…

Q: Could two mRNAs have different nucleotide sequences and yet code for the same protein? Explain your…

A: All humans are made up of numerous cells. Cells are the basic building blocks of an organism. Cells…

Q: Choose the answer that has these events of protein synthesis in the proper sequence. 1. A TRNA binds…

A: In translation, the newly formed mRNA is decoded in a ribosome. The ribosomes facilitate decoding by…

Q: What is the role of ribosomes in protein synthesis? * A. they carry proteins to the site of action…

A: Protein synthesis takes place in the cytoplasm. The mRNA is read in the pair of three bases at a…

Q: You are studying with a friend who says that the hydrogen-bonded portions of tRNA play no important…

A: tRNA is a short nucleotide RNA chain with L-shaped structure. A tRNA molecule is required for…

Q: An American biochemist Erwin Chargaff discovered that in the cells of all organisms he studied, the…

A: Introduction :- All living things are made up of cells, which are the basic building blocks. There…

Q: The ribosome is needed for translation of mRNA

A: Protein synthesis is a fundamental molecular phenomenon that takes place in the cytosol. It occurs…

Q: Scientists wanted to determine what molecule held the 'gene'. If they did a study in which a cell…

A: The flow of genetic information in a biological system is explained by central dogma and it involves…

Q: When does a peptide bond form during translation? 1) When the P-site and E-site are occupied by TRNA…

A: mRNA is translated to form protein through the process translation with the help of ribosome, tRNA.…

Q: Messenger RNA ____________________. a. Carries amino acids to the ribosome b. Carries information…

A: DNA is converted into mRNA, this process is known as transcription. mRNA is converted into protein,…

Q: What process is the P site in a ribosome most closely associated with? a. Binds the tRNA…

A: Ribosomes are complex cell organelles, which are composed of ribonucleic acid (RNA) and ribosomal…

Q: The relationship between the gene and the synthesis of a specific protein: Describe the steps in the…

A: Answer:- Relationship between gene and synthesis of specific protein:- there are many protein which…

Q: Enzymes, proteins and deoxyribonucleic acid (DNA) are important biological macromolecules. Enzymes…

A: Protein synthesis is the process where cells make proteins and occurs in two stages: transcription…

Q: Which statement is true of the translocation phase of elongation during protein synthesis? a. The…

A: The translation is the process by which ribosome synthesis protein using mRNA. It consists of three…

Q: Predict what the results would be if mRNA were radioactively labeled instead of polypeptides. Give…

A: mRNA stands for messenger RNA. It is a single-stranded molecule that is complementary to one of the…

Q: The job of tRNA is to O A. bring amino acids to the ribosome by matching their anticodon to the…

A: The genetic material is used to store the genetic information in the mitochondria or nuclei of an…

Q: Below is a short segment of a DNA molecule. Transcribed the DNA codon into mRNA. Use your data sheet…

A: Transcription is the process by which RNA polymerase read out DNA template stand and synthesize…

Q: This model represents protein synthesis since the TRNA is delivering amino acids to form a…

A: The two main steps involved in protein synthesis are: transcription and translation. These two…

Q: Which statement is not true about hsitone ? A-They are positively charged at biological pH B-Most…

A: The nucleosome is the basic structural unit of chromatin. This contains 8 histones in a bead and 1…

Q: Use the model to answer the following questions. 1. Which of the arrows (1 or 2) represents…

A: Transcription is the process of formation of mRNA on DNA template catalyzed by RNA polymerase.…

Q: how does eukaryotic ribosome find the mRNA to be translated? A. the sigma factor B. the…

A: the 5' cap

Concept explainers

Cancer Therapy

Question

Treating a cell with a drug to stop tRNA from doing its job would mean what?

A. that ribosomes would fall apart

B. that sugars would not be added to proteins

C. that nothing would be available to translate

D. that amino acids would not be brought to the growing protein

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Introduction:

VIEW

The correct choice:

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

What is the role of transcription in the determination of the amino acid sequence of a polypeptide chain? A. It pairs anticodons and codons. B. It synthesizes an mRNA strand. C. It duplicates the information in DNA. D. It decodes the information from mRNA.
Why was the cold ethanol added to the soap and salt mixture? A To digest the cell walls B To dissolve the RNA C To emulsify lipids and remove large cellular debris D To precipitate the DNA E To denature the cytoplasmic proteins
A scientist isolates some mRNA from one gene and compares its sequence to that of the gene from which it was copied. Where will the mRNA be found to end? A. at the promoter B. at an intron C. at the stop codon D. at an enhancer
Which statement is true of the translocation phase of elongation during protein synthesis? a. The empty tRNA moves to the A site of the ribosomal complex. b. The empty tRNA moves to the T site of the ribosomal complex. c. The dipeptide moves from the A site to the P site of the ribosomal complex. d. The dipeptide moves from the P site to the A site of the ribosomal complex.
Which statement BEST DESCRIBES the genetic code? A. There can only be one codon for multiple amino acids. B. There are only 10 different amino acids in proteins. C. More than one codon for a specific amino acid. D. The genetic is misinterpreted to have U instead of T.
Which event contradicts the central dogma of molecular biology? a. Poly-A polymerase enzymes process mRNA in the nucleus. b. Endonuclease enzymes splice out and repair damaged DNA. c. Scientists use reverse transcriptase enzymes to make DNA from RNA. d. Codons specifying amino acids are degenerate and universal.
What process is the P site in a ribosome most closely associated with? a. Binds the tRNA molecule carrying the next needed amino acid to the mRNA strand b. Transcription of DNA to RNA c. Release of a tRNA molecule from a ribosome d. Anchoring of the tRNA holding the growing polypeptide
Which is true about eukaryotic cDNA? Choose all that apply a. it is single stranded b. it is made up of only introns c. it is constructed from mRNA that is reverse transcribed d.
What is meant by the term DNA replication? a. synthesis of nucleotides b. cell division c. interpretation of the genetic code d. the exact copying of the DNA code into two new molecules
Describe the function of the ribosome in two sentences.
After ingesting a bacteria, macrophages process bacterial parts and ‘present’ them to acquired immunity cells so the acquired immune cells recognize these invaders again in the future. The antigen-presenting proteins ultimately end up in the plasma membrane. Where did it receive the post-translation modification that determined its final location? a. The ribosome b. The ER c. The Golgi d. The vesicle
Tetracyclines are a class of prokaryotic antibiotic that ?? A. Consist of lactone rings and target the 50s ribosomal subunit to prevent protein synthesis B. Consist of a napthacene ring and target the 30s ribosomal subunit to prevent protein synthesis C. Consist of aminoglycosides and target folic acid formation D. Consist of a B-lactam ring and prevent transpeptidation during cell wall formation