Answered: Explain why cell biologists predicted…

Explain why cell biologists predicted that the genetic code would be based on a 3-base codon. (b) How did early cell biologists confirm it was a 3-base codon?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 3QP: If the genetic code used 4 bases at a time, how many amino acids could be encoded?

See similar textbooks

Related questions

Q: Which amino acid(s) have the most codons? Which amino acid(s) have the fewest codons? Can you think…

A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…

Q: Taking start and stop codon into consideration, if we have an mRNA sequence with 30 nucleotides, how…

A: Peptides are peptide bonds that connect short chains of amino acids. Dipeptides, tripeptides, and…

Q: If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA…

A: DNA is a double stranded helical structure found generally in Eukaryotes and prokaryotes while in…

Q: What evidence supports the view that ribosomal RNAs are a more important component of the ribosome…

A: The discovery of ribozymes was the first indication of rRNA's importance (catalyze peptide- bond…

Q: Is it reasonable that codons for the same amino acid have one or two nucleotides in common? Why or…

A: Proteins are synthesized via translation of mRNA> The tripeptide sequence on the mRNA that codes…

Q: If the genetic code were overlapping, how many complete codons would the followingsequence encode…

A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…

Q: Explain The Genetic Code?

A: Genome of the organisms is inscribed in their DNA or in RNA (in some viruses). The part of the…

Q: Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about…

A: Introduction: 20 amino acids make up all the proteins. These are the building blocks of proteins…

Q: What is most closely associated with the cell organelle in the process represented in the diagram ?…

A: Cell is the smallest structural and, functional unit of life. It is simple machinery that houses all…

Q: Explain the genetic advantage for the codon 5'-AAG-3' to code lysine and the codon 5'-AGG-3' to code…

A: Introduction Any of the 64 distinct DNA sequences of three consecutive nucleotides that either…

Q: Provide a chemical explanation of why DNA synthesis proceeds in a 5'- to-3' direction.

A: The genes are the hereditary unit of an organism which are passed on from the parental generation to…

Q: Which of the following best describes a stop codon?

A: Stop Codons constitute of three nucleotide sequence of m-RNA that doesn't code for any amino acid.…

Q: If the DNA template strand was TACCTAGAT, what would the mRNA codons be?

A: This process is called transcription i.e synthesis of m RNA from DNA. The DNA strand that forms m…

Q: For each codon below, give the tRNA anticodon. 3. UUC 4. AUC 5. CCG 6. CGU

A: Anticodons are the three complementary bases present on the tRNA. On the basis of the anticodon, the…

Q: ribe the crucial role of base pairing between codon and anticodon.

A: The hereditary material translated into messenger RNA is expressed by the triplet code (mRNA). The…

Q: The genetic code uses three bases to encode one amino acid. Why can't the code use only two bases to…

A: Genetic code is a triplet code that consist a set of three nucleotide bases, known as codons. Each…

Q: explain why a mutation in the dna nucleotide sequence that corresponds to the 3rd nitrogen base in…

A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…

Q: What is the structure and components of the nucleosome? Briefly explain with your words.

A: Nucleosomes are particles made up of histone proteins around which DNA is wrapped.

Q: The genetic code is based on four different bases with the structures shown here. Determine the…

A: Nitrogenous base is a molecule that contains nitrogen and has the chemical properties of a base. The…

Q: Why do DNA chips often contain segments derived from cDNA rather than genomic DNA segments?

A: DNA chip used in microarray

Q: Discuss why you think the ribosomes need to contain so many proteins and rRNA molecules. Does it…

A: Ribosomes are present in both plant and animal cells. they are present in both prokaryotic and…

Q: The human genome has 3.3 billion bases, of which 3% codes for protein. If a codon were four letters…

A: In most organisms, genetic information is stored in the form of the nucleotide sequence of DNA. This…

Q: Would you expect tRNA or mRNA to be more extensively hydrogen bonded? Why?

A: RNA is a polymer of nucleotide where it is composed of a ribose sugar, phosphate group, and a…

Q: If one codon codes for two nucleotide than how many possible codons are there?

A: To find: How many codons are possible if one codon codes for two nucleotides

Q: Look at the MRNA strand below. There are at least a few bases before the "AUG" or the start codon.…

A: Several codons or triplet bases make up the universal genetic code. Over time, the standard code has…

Q: What is meant by the statement “The genetic code is universal”? What is the significance of this…

A: DNA is deoxyribonucleic acid that contains genetic information. Gene is a segment of DNA that can…

Q: In a particular region of the genome of a certain bacterium, one DNA strand is transcribed to give…

A: 1 a) No, there wont be any problem in expressing the two genes. But in bacteria, most of the gene…

Q: Suppose that codons consisted of 4 nucleotides instead of 3 and that there were only 2 different…

Q: Look at the codon "UUU" in the codon chart. If the 3rd nucleotide (3rd Uracil) was mutated to a "C"…

A: The genetic code is triplet code called codon.The genetic code is degenerate meaning that given…

Q: Compare the codons with a pyrimidine, either U or C, as the second base. Do the majority of the…

A: Codons are the trinucleotide sequence of DNA or RNA that codes for specific amino acids. There are…

Q: Why did DNA, rather than RNA, evolve to be the carrier of genetic information in cells?

A: This is one of the primary dissimilarities between DNA and RNA. DNA (Deoxyribonucleic acid) is the…

Q: Describe the composition and structure of the nucleosome.

A: A cell is the fundamental unit of life. All living organisms are made up of one or many cells. The…

Q: If a mutation changed the start codon into a stop codon, would this mutation affect the length of…

A: Mutations are the changes in the base sequences of the nucleotides in a gene. They are known as gene…

Q: Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space…

A: b) UUA: Leucine c) GAG: Glutamate d) UAU CUA: Tyrosine-Leucine e) AUC UUG: Isoleucine-Leucine

Q: A triplet code with three nucleotides per codon is the most efficient way to encode the 20 different…

A: Nucleotides are the building block of nucleic acid whereas amino acids are the building blocks of…

Q: Look at Table 26.3 and find codons for the following amino acids:(a) Val (b) Arg (c) Ser

A: Codons are the triplet base of the nucleotide sequence, which encodes the amino acids during…

Q: If instead of 20 amino acids there were 200 amino acids, then how many nucleotides would you be…

A: An mRNA directs the insertion of single amino acid to a protein per three nucleotides. A codon is a…

Q: Translate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'

A: Translation: Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: Codon to be read in the mRNA is 5' GAA 3', what is the amino acid? a. E b. K c.F d.L

A: Dear student answer of your question is given below: Given codon in the mRNA is 5' GAA 3' , It…

Q: Describe the structure of the nucleosome

A: In eukaryotes, DNAs are condensed and packed along with several proteins to form the chromatin…

Q: What is the Evidence that each nucleotide is part of only one codon?

A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…

Q: Explain the reasoning establishing that a sequence of three nucleotides (a triplet codon) is the…

A: The nucleotide can be defined as the basic building block of nucleic acids. RNA and DNA can be…

Q: If proteins were composed of only 12 different kinds of aminoacids, what would be the smallest…

A: A codon is a sequence of 3 DNA/RNA nucleotides that corresponds to a specific amino acid during…

Q: a. There are three nucleotides in each codon, and eachof these nucleotides can have one of four…

A: The genetic code is a system of principles that live cells employ to convert data contained in…

Q: Explain, on the basis of nucleotide structure, why DNA synthesis proceeds in the 5’-to-3' direction.

A: The deoxyribonucleic acid (DNA) is known as a double helix structure in which two strands are joined…

Q: One remarkable feature of the genetic code is that amino acids with similar chemical properties…

A: Introduction :- The genetic code is made up of codons, which are three-letter nucleotide pairings…

Q: Which amino acid is at the beginning of every eukaryotic protein and why?

A: The genetic information is transferred from DNA to RNA and from RNA to protein. This flow of genetic…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

Explain why cell biologists predicted that the genetic code would be based on a 3-base codon.

(b) How did early cell biologists confirm it was a 3-base codon?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

If the genetic code used 4 bases at a time, how many amino acids could be encoded?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for proteins in this mRNA?c. what stop codon is present in this mRNA?
Once translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?
a. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? b. If a single transversion occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? c. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence? d. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?
How many codons would exist in a genetic code that had codons that were four bases long? Why? (show the equation for calculation)
If the genetic code were overlapping, how many complete codons would the followingsequence encode before encountering a stop codon? And which stop codon would it be? 5′ - AUGCGAUUAAAGUGC - 3′
Explain what is meant by stating that the genetic code is triplet and nonoverlapping? What did the finding that DNA base composition varied greatly among different organisms suggest about the genetic code? How was the identity of the UUU codon established?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #3) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for a protein in this mRNA?c. what stop codon is present in this mRNA?
Explain the reasoning establishing that a sequence of three nucleotides (a triplet codon) is the basic unit of the code relating DNA to protein?
The human genome has 3.3 billion bases, of which 3% codes for protein. If a codon were four letters instead of three, what percentage of the genome would have to code to generate the amount of protein?
Which amino acid would be attached to a tRNA that read "GGU"?
a. There are three nucleotides in each codon, and eachof these nucleotides can have one of four different bases. How many possible unique codons are there?b. If DNA had only two types of bases instead offour, how long would codons need to be to specify all20 amino acids?