Q: 19. Which of the following is true about cardiac muscle? A. It is voluntary and striated B. It is…
A: Muscles These are soft tissues. There are three types of muscles in human body. These are: Smooth…
Q: Write the characteristics of the seven taxonomic hierarchy in sentences/ paragraph and their…
A: The seven taxonomic hierarchy is.. species, Genus, Family, Order, Class, Phylum or Division and…
Q: explain why there are more similarities between humans and chimpanees than between human and dogs.
A: Monkeys, chimpanzees, and humans are primate groups. Primates are vertebrates that are portrayed by…
Q: Using a T chart illustrate the differences between type I diabetes and type II diabetes.
A: Introduction Diabetes is a group of disorders that impact your body's ability to use blood sugar…
Q: Which of the following organisms practice internal fertilization and external development. Chickens,…
A: Introduction :- Internal fertilisation is the joining of an egg and sperm cell inside the female…
Q: NUMBER OF CARBON GAS (CO2) IN THE ATMOSPHERIC AIR 1.0,03-0,04% 2. 0,07 3. 0,1 4. 0.3 5. 4,0
A: Earth's atmosphere is composed of about 78% nitrogen, 21% oxygen, and one percent other gases.
Q: Why do yeasts generally have to be cultured for longer periods than most bacteria? Can…
A: Note :-Since you have asked multiple questions im only answering the ist 3 as per bartleby…
Q: Question 1 a. What are the potential roles for calcium sparks in cardiac disease states? b.…
A: The ABO blood grouping is regulated by a single gene present on chromosome 9 and such gene is…
Q: How can you protect yourself from diseases that can be acquired from the environment?
A: 1)Good hygiene: the most important way to prevent infectionsThe first line of defense is the control…
Q: How does the Red Queen hypothesis affect coevolution between host species and parasites?
A: Introduction A parasite is an organism that lives on or in its host and feeds on or at the expense…
Q: Phosphorylase kinase integrates signals from thecyclic-AMP-dependent and Ca2+-dependent…
A: Phosphorylase kinase which is abbreviated as PhK, has the responsibility to coordinate hormonal as…
Q: What role does each component of the ear play in transmitting vibrations that enter the outer ear…
A: The ear is a vital organ that is responsible for both hearing and maintaining body balance. The…
Q: What are the importance tof ants o other organisms and to the environment
A: The ant is one of the world's most strongest animals comparable to its size. A single ant can carry…
Q: First food chain Second food chain Trophic level Organism Trophic level Organism
A: First food chain Trophic level organism Level 1 (Producer) Diatoms and other phytoplankton.…
Q: Examine the variegated leaf shown in Figure Q14–3.Yellow patches surrounded by green are common,…
A: Chloroplast and mitochondrial DNA are usually define the that they are been maternally inherited in…
Q: 1. oxidability 2. residual chlorine 3. ammonia 1. nitrites, nitrates 5. chlorides 5. sulphates
A: Chlorination is the process of adding chlorine to drinking water to kill parasites, bacteria, and…
Q: i need the answer quickly
A: Dust is of following types: - Visible Microscopic Ultra Microscopic Visible is filtered out at the…
Q: Which of the following - if it had occurred - would have resulted in the myxoma virus in Australia…
A: Introduction Myxoma virus is a poxvirus in the genus Leporipoxvirus. Myxomatosis is caused by the…
Q: If a plant’s stomata are made to stay open at all times, orclosed at all times, it will die. Why?
A: Stomata are the tiny holes which are present on the surface of the leaves. The function of the…
Q: 1. Here is how to start. You have to show the derived characteristic for each phylum (red) on top of…
A: Derived traits and Primitive traits Every individual bears some kind of characteristics specifically…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A:
Q: DUST PARTICLES HAVING MICROSCOPIC SIZE (0.25-10MKM) 1. quickly within a few minutes settle according…
A: According to the dispersity, dust particles are comprised of different sizes- visible (greater than…
Q: THE EFFICIENCY OF NATURAL VENTILATION IS DETERMINED BY 1. the frequency of air exchange 2. the…
A: Natural ventilation is one of the most basic methods for reducing energy use in buildings. The need…
Q: The intracellular matrix differs from the extracellular matrix in that the latter is located A…
A: Q. The intracellular matrix differs from the extracellular matrix in that the latter is located A…
Q: This pedigree chart shows the transmission of a trait in a particular family. Based on this pattern…
A: Answer is mitochondrial pattern of transmission. In mitochondrial transmission, disease is…
Q: Compare the characters of lemuroidea , Tarsioidea and Arthropoidea. Pls make a chart or table so I…
A: Lemuroidea , Tarsioidea and Arthropoidea are the 3 suborders of order primates, and subclass theria…
Q: With the exception of olfaction, all sensory pathways first travel to the ________, which acts as a…
A: Introduction :- The thalamus is a diencephalon structure that is primarily grey matter and plays…
Q: giving examples to illustrate your answer define both selective media and enrichment media as might…
A: Every microbiologist must eventually grow bacteria in the lab for research purposes. Bacterial…
Q: Gregor Mendel: CHECK ALL THAT APPLY conducted research that proved that the "blending hypothesis"…
A: Introduction Gregor Mendel:- He was an Austrian scientist, teacher, and Augustinian prelate who…
Q: 4. Give at least 2 major contributions of Cambrian explosion to evolution
A: 4. The Cambrian Period is significant in the evolution of life on Earth since it is when most of the…
Q: What did Enterobacter aerogenes to do with the Lactose negative go to the Serratia liquefaciens?…
A: Enterobacter aerogenes is a gram negative rod shaped bacteria that causes several infections in the…
Q: How could you prove that the Tn5 insertion was in the lac operon?
A: Genetic engineering (GE) is the intentional change of an organism's genetic structure, which…
Q: In contrast to our jaws. which move up and down, the mouthparts of arthropods move side to side.…
A:
Q: Define the following terms: a. Chermolithoheterotroph b. Microaerophile c. Chermoorganoheterotroph…
A: The living world, as we all know it, can predominantly be divided into - Plants and Animals. Apart…
Q: AT THE ESTIMATION OF THE VALUE OF THE COEFFICIENT OF NATURAL LIGHTING, USE THE DEVICE 1. Krotov's…
A: Krotovs apparatus used for bacteriogical air research. Cathetertometer is urine meter. Anemometer…
Q: discuss an autoimmune disease
A: Introduction The immune system is a complex system of the body that includes cellular as well as…
Q: 1. Explain in 2 sentences why Evolution walks a perilous tightrope between continuing and ending.
A: "Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Give the common characteristics of animals that falls under the category of Family: Felidae in…
A: INTRODUCTION Felidae is a clade of mammals belonging to the order Carnivora and is commonly referred…
Q: Genotypic Ratio: Phenotypes: Phenotypic Ratio: Rr Genotypes. Genotypic Ratio: Phenotypes: Phenotypic…
A: In order to explain the inheritance pattern Mendel gave three laws -law of dominance, law of…
Q: Not all Americans are willing to get the covid-19 vaccine, and not all countries have enough…
A: Vaccination : A biological preparation that can be used to activate the immune response in the body…
Q: The diagram below represents results of agarose gel electrophoresis performed after PCR…
A: Please follow step 2 for detailed explanation.
Q: 5. 5. Draw a phylogeny the following taxa: shark; tuna; frog; lizard; mouse; whale. On your…
A: Evolution solved the challenge by developing the cellular differentiation process, which resulted in…
Q: vascular cylinder, vascular bundle, ground tissue, epidermis , palisade mesophyll, spongy mesophyll,…
A:
Q: 2. Why is oxygen when unbound to any other material can be toxic to life? 3. What is the role of…
A: 2. By its proclivity for univalent reduction, which results in the production of reactive oxygen…
Q: 4. The difference in charge between the outside and the inside of a neuron at rest is called: A.…
A: Introduction Membrane potential:- It is a potential gradient that forces ions to passively move in…
Q: Calculating the probability of two parents - each coming from a large family with a history of a…
A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…
Q: Assume for a moment that crossing-over did not occur. Would you agree that you received half of your…
A: Crossing over is a phenomenon that develops in novel gene combinations by transferring and swapping…
Q: Please i really need the right answer there is mutiple queshtions and i need the right answer and…
A: B is the correct answer. Multiple alleles occur when there are more than two possible alleles for a…
Q: Portal System 1. What visceral organ system uses the portal system extensively?
A: Portal system in the body can be defined as a system in which blood present in one set of…
Q: Label the structures of the lymphatic system in the accompanying figure. ch Lymphatic vessel…
A: Lymphatic system Lymph is a colourless fluid that contains the immunity cells or the white blood…
Can you explain why the answer is true or false for this question?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- true or false, Sexual selection may lead to sympatric speciationThe magnification of genetic drift as a result of natural events or catastrophes is _____; _____ is the flow of alleles in and out of a population due to the migration of individuals or gametes.The evolution of one species into two or more species as a result of different populations becoming reproductively isolated from each other is best termed as adaptive radiation. True or False.
- Genetic drift can produce large changes in allele frequencies in a short time period. true or false"Populations can adapt via genetic drift." Please explain in detail why this is false and a misconception.Founder effects are most prominent in geographically, culturally or religiously isolated populations that undergo rapid expansion from a limited number of ancestors, when, as a consequence of low genetic diversity, some alleles become more frequent. True False
- Which of the following is most likely to cause changes in wing color allele frequencies in Dumbledore beetles over a 10 year period? These beetles live on islands, are weak fliers, have small populations, and fitness does not vary with wing color.In general, what is the effect of complete selection, migration and random genetic drift on the gene frequencies of the population? complete selection migration random genetic driftTrue or False: Microevolution is commonly observed in real-time
- Changes in environmental conditions can render previous adaptations as maladaptations. Describe an example of maladaptation in humans during the last 100,000 years. Your answer should include a discussion of the relevant environmental factors, fitness (in both environments), and specific variants (genotypes).When considering similarity between species in heritable characteristics, the lack of homology is homoplasy. True OR Falsein what ways would you expect forced migration to have an impact on the phenotypes of animal populations over the next 100 years? What are expected impacts on the genetic structures of these populations?