Use the following sequence data to assign haplotypes and build a haplotype network for a 200 bp variable region that is sequenced from eight individuals. Polymorphic nucleotide positions are shown. Δ is a 1 bp deletion. Explain the logic supporting the network. If there are different nucleotide changes at one position, indicate the different changes on your network. Individual 24 56 92 119 146 172 haplotype 1 A C A T G G A 2 T C Δ C G G 3 A G A T A T 4 A G A T G T 5 A C Δ C G G 6 A G A T G G 7 A G A T A T 8 C C Δ C G G

Use the following sequence data to assign haplotypes and build a haplotype network for a 200 bp variable region that is sequenced from eight individuals. Polymorphic nucleotide positions are shown. Δ is a 1 bp deletion. Explain the logic supporting the network. If there are different nucleotide changes at one position, indicate the different changes on your network. Individual 24 56 92 119 146 172 haplotype 1 A C A T G G A 2 T C Δ C G G 3 A G A T A T 4 A G A T G T 5 A C Δ C G G 6 A G A T G G 7 A G A T A T 8 C C Δ C G G

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 1ITD: You learned in the chapter that an STR locus is a locus where alleles differ in the number of copies...

See similar textbooks

Similar questions

A method for detecting methylated CpGs involvesthe use of a chemical called bisulfite, which convertscytosine to uracil but leaves methylated cytosine untouched. You want to know whether a particularCpG dinucleotide at one location in the genome ismethylated on one or both strands in a tissue sample.The genomic sequence containing this CpG is:5’...TCCATCGCTGCA…3’. You take genomicDNA from the sample tissue, treat it exhaustivelywith bisulfite, and then use flanking primers toPCR-amplify the region including this CpGdinucleotide. You then want to Sanger sequence(see Fig. 9.7) the amplified PCR product. a. After you treat genomic DNA with bisulfite, the twoDNA strands will melt into single strands. Why?b. Your answer to part (a) introduces a potential complication, because if you do not account for this result of bisulfite treatment, the PCR primers willnot amplify the DNA. What special considerationswould be necessary when you design your PCRprimers for this experiment? Could one pair…
5. A haplotype is a specific set of SNPs and other genetic variants observed on a single chromosome or part of a chromosome, as compared between individuals in a population. Shown below are eight DNA sequences from different individuals: Nucleotide Position 1 5 10 15 Sequence 1. TCTGGAT CAT CACAT Sequence 2. ACAGCAT CATIA CGT Sequence 3. TCAGGAT CATIA CAT. Sequence 4. TCAGGAT CATI A CAT. Sequence 5. ACAGCATCATI ACGT Sequence 6. TCT G GAT CAT CACAT Sequence 7. TCAGGAT CATI A CAT. Luis Pagoada Sequence 8. ACAGCAT CAT IACGT. a. Give the nucleotide positions of all single nucleotide polymorphisms (SNPs; nucleotide positions where individuals vary in which base is present) in these sequences. b. How many different haplotypes (sets of linked variants) are found in these eight sequences?
Answer the following MCQs: 1:This database is most likely to have data about gene expression. GenBank BLAST dbEST RefSeq PDB 2: Dot matris noise reduction: window size is 7 by 7 and mismatch is 2. What is the minimal number of matches in this window that allows us to place the dot? 2 3 1 5 4 3: Find the optimal global alignment of two DNA sequences _ACAAC and AC. Match = 2, mismatch =0, gap opening =-3, gap extention=-1. What is the total score of alignment? 2 -1 0 -3 1
in 3-5 sentences max. Describe how it is that when a short tandem repeat (STR) genomic region is PCR-amplified you can get 1 or 2 different-sized products using the same primer pair with only 1 person’s genomic DNA as the template?
Q. What is the best analysis for estimation of family sequence conservation of domains? Enlist any two tools through which we can perform this task? (Subject Bioinformatics).
DNA from a strain of Bacillus subtilis with the genotype trp+ tyr+ was used to transform a recipient strain with the genotype trp− tyr−. The following numbers of transformed cells were recovered: Genotype Number of transformed cells trp+ tyr− 154 trp− tyr+ 312 trp+ tyr+ 354 What do these results suggest about the linkage of the trp and tyr genes?
Can you further explain the second primer how we get that and possibly draw it out? GTCAAATTACATTACACATAA
Select all that apply: A SNP (single nucleotide polymorphism) is similar to an STR (short tandem repeat) in that: a) an individual can have many different copies of specific SNP or STR b) they both cause diseases c)they are sequences that have many possible variants d) an individual has one copy of this region of the genome from each parent.
please solve the following: (a)Explain how a mutation effects a genotype. (b) Explain how a mutation may or may not effect a phenotype. (c)What is the difference between DNA replication, transcription, and translation. What are the products in each, and what are they used for? please solve accurate and exact.
If you compare the frequency of the sixteen pos-sible dinucleotide sequences in the E. coli and humangenomes, there are no striking differences except for onedinucleotide, 5ʹ-CG-3ʹ. The frequency of CG dinucleotidesin the human genome is significantly lower than in E. coliand significantly lower than expected by chance. Why doyou suppose that CG dinucleotides are underrepresentedin the human genome?
See the attachment and answer the following parts of the question: A) If the binturong genome is 2.87 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'ATGGTCC3' and its complement, how many copies of this sequence are present in the binturong genome? B) Briefly explain, in your own words, why the fraction of the binturong DNA fragments that reannealed relatively slowly took so much longer to renature than the other DNA fragments. C) If you took more of the same randomly generated 1000 bp fragments of binturong DNA (the same sample that you used in the equilibrium density gradient centrifugation experiment described in part a and the C0t curve described in part b of this question) and used them as a sample in agarose gel electrophoresis, how many bands would you expect to find in the gel when you turned off the current and stained the gel with ethidium bromide? Briefly explain why you would predict that number of bands.
Draw a genetic diagram & suitable symbols