Using appropriate examples, describe some of the ways thatgenetically engineered microorganisms are used

Q: Suppose a population has two alleles at a particular locus, and individuals with different diploid g...

A: Hardy Weinberg’s principle is the mathematical representation of population analysis which calculate...

Q: Two albinos marry and have four normal children. Howis this possible?

A: Introduction Albinism is a genetic condition that causes a person's skin, hair, and eyes to be excee...

Q: Make and defend a claim based on evidence that the process of independent assortment during meiosis ...

A: independent assortment is a regulation of heredity that explains how individual genes and alleles in...

Q: Human Karyotype B (questions #7 to #12) 7. The diploid number is 46. 8. The haploid number is 23 onl...

A: Karyotype: A karyotype is a collection of all metaphase chromosomes in a species' or individual orga...

Q: 1. Why are protist, plants, fungi and animals classified into the same domain but into different kin...

A: Introduction All plants, animals, and microbes on the planet are included in taxonomy, which is the ...

Q: Myosin heads bend when attached to actin

A: Correct option is C  Myosin heads bend when attached to actin  

Q: Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical pro...

A: ANSWER;-  Forward primer:Sequence = 5'-CT-GAATTC-ATGGCTAAAGGCGGAGCT-3'Length = 18 ntdGC content = 56...

Q: Which statement best explains why a third domain, Archaea, was added to the original two domains of ...

A: Introduction: Prokaryotes were thought to be the first living organisms on Earth, according to paleo...

Q: Which Class I element has likely experienced the greatest accumulation of mutations compared to its ...

A: Transposable elements are the Jumping genes which are the mobile genetic material within the genome....

Q: The nervous tissue that consists of myelinated axons transmitting information throughout the central...

A: The white matter refers to the sections of the brain and spinal cord that communicate between the va...

Q: Suppose that you are asked to write a new class for DNA. What are the main attributes and functions ...

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and...

Q: 1. Read the paragraphs below. For each paragraph, write the letter of the diagram from the diagram s...

A:

Q: G6PD deficiency is an X-linked recessive disorder. When people who have this disorder eat fava beans...

A: An X-linked trait is regulated by the genes present on the X chromosomes.

Q: For fruit flies, N=4 and 2N=8 a. Sketch a dividing fruit fly cell which is in prophase I. b. Sketch ...

A: NOTE: Since you have asked multiple questions So we will solve the first par for you. as per our com...

Q: Define about Cloning Vectors ?

A: A cloning vector is a small piece of DNA that accepts the target DNA and multiple its copies manifol...

Q: Tolerance in the Thymus for CD4+ and CD8+ cells is carried out where? What is meant by positive and ...

A:

Q: An il or injured patient may have suffered from damaged tissues that the cell cycle, including mitos...

A: Cloning is the procedure of creating a new multicellular organism, genetically identical to another,...

Q: How does the Coriolis “Force” affect ocean productivity? How does it affect the world’s major fisher...

A: Coriolis force or Coriolis effect is the deflection of wind towards the right in the Northern hemisp...

Q: What are the developmental stages of Trypanosama? Describe how the stages appear

A: Trypanosoma is one celled , protozoan with flagella which comprises of digenetic life cycle . It inv...

Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...

A:   Here,  human DATP gene sequence of human is given , i.e :  ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC

Q: Can the amount of available energy on a given trophic level be larger than the available energy on l...

A: Answer 

Q: comprise the membrane. If you isolated a single transmembrane helix from a protein from this strain,...

A: Since the newly identified bacteria has normal nucleic acids and proteins - the amino acids in the p...

Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...

A: Flies belong to the order Diptera, which has evolved advanced mechanosensory organs known as haltere...

Q: Explain about the following picture, which represents the heart

A: The given picture is a Histology slide of a Cardiac muscle.

Q: Explain how early genetic screening can help a baby.

A: Genetics screening is a procedure in which the whole genetic makeup of an individual is tested. This...

Q: Tell how to make a 1 M solution of Mg3(PO,), and a 0.1 M solution of caso,. Ca.SO4.

A: The term molarity can be used to describe the solute concentration in a particular solution. The for...

Q: Four E. coli strains of genotype atb¯ are labeled 1, 2, 3, and 4. Four strains of genotype a¯b* are ...

A:

Q: a) give the definition to the «nitrogen balance» and whether or not it is changed in the patient; b)...

A: A)Nitrogen Balance is the difference between the Nitrogen intake and loss . If more nitrogen content...

Q: motner nas a nign neteroplasmiC load in ner germ celiS (celis that Will produce ner eggs). Which the...

A: Within a cell or person, heteroplasmy refers to the existence of more than one form of organellar ge...

Q: You are studying a small eukaryotic gene of about 2000 bp in length. About how many copies of histon...

A: There are histone octamers found in the genetic arrangement whose knowledge can be used to answer th...

Q: Question:  How has having an opossable time thumb helped primates, especially humans to adapt to th...

A: Having an opossable time thumb helped  humans especially to adapt to their environment and better su...

Q: How does methylation affect development in terms of epigenetics, cancer, and general development?

A: Answer :- Cancer cells contain adjusted DNA methylation designs. There is a lot of lessDNA methylati...

Q: The dinosaurs died out______ million years ago

A: Introduction:- Dinosaurs are a diversified group of reptiles that dominated Earth's terrestrial life...

Q: Differentiate the staining procedures. Gram Stain Acid Fast Endospore Capsule Flagella a) Principle ...

A: Your filled table attached below

Q: 3. An enzyme with a Km of 0.06 mmol/L hydrolyzed a substrate of a concentration 0.03 mmol/L. The ini...

A: Michaelis and Menten equation: V=Vmax [S]/ Km +[S] 

Q: How might understanding population dynamics help us better manage this invasive species and its impa...

A: Population Dynamics is the study of the Population characteristics like size ,density of the populat...

Q: A trait that is exclusive to a group of animals but different from what their ancestor had is called...

A: Traits are evolved for many reasons including the survival, reproduction, food availability and many...

Q: Black body (b) and purple eye (pr) are recessive autosomal mutations in Drosophila. Bridges are cros...

A: b - allele for black body - recessive pr - allele for purple eye - recessive B - wild type for body ...

Q: 1: Where was the Nariokotome Boy Found? How long ago did he live? How old was he? 2: What species do...

A: Nariokotome Boy or Turkana Boy:- About 1.8 million years ago, a boy died and this specimen is the mo...

Q: QUESTION 1 Entamoeba histolytica is able to infect humans, moves using pseudopods, and is the most p...

A: Entamoeba histolytica was first discovered by Lambl in 1859 and its pathological nature was proved b...

Q: In your own words, kindly give the function and allowable limit (if applicable) of each of the follo...

A: All the given ingredients have their own health benefits. These ingredients are essential and have a...

Q: . The genotype r/r ; p/p gives fowl a single comb, R/− ; P/−gives a walnut comb, r/r ; P/− gives a p...

A: Comb in poultry is defined by two genes usually designated as R and P.  When only the dominant allel...

Q: How would you differentiate the following structures when seen in an unstained smear:   a. Phagocy...

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for...

Q: A breeder performed a testcross to find out if his male dog was a purebred black. He got one brown p...

A: Introduction :- An experimental hybrid between an individual organism with a dominant phenotype but ...

Q: MLS supervisor is writing an Standard Operating Procedure (SOP) for running a PC test for Hepatitis ...

A: 1. Ongoing quantitative PCR for HBV DNA DNA was extricated from 200 μL of serum utilizing the QIAamp...

Q: H* ions generated by reactions in the electron transport chain, as well as H* ions present in the ma...

A: The electron transport chain is a series of reaction in  four protein complexes, taht creating an el...

Q: Which of the following statements accurately describes the pattern of recruitment in a muscle when p...

A: The contraction of muscle is responsible for the development of muscle movement. The generation of s...

Q: Question 7 "In UAE, you can breed goats and sheep during the winter time only True False

A: Goat and sheep in UAE: usually, these animals are an important source of food in UAE. That's why bre...

Q: Distinguish between polyploidy and aneuploidy

A: A chromosome is a tiny thread-like structure found in the nucleus of eukaryotic cells (animal and pl...

Industrial Processes

Industrial processes result in the manufacturing of products (biological products, such as enzymes, medicine) on a large scale using different methods, such as physical and chemical procedures. Few products such as pharmaceuticals, agricultural products, food items, etc., involve microbes and their enzymes. Such processes are termed industrial biological processes. Microbiology and biotechnology enable us to utilize the ability of microorganisms to produce enzymes, primary metabolites, and secondary metabolites, which in turn help to produce the desired products.