Q: A population of bats becomes isolated after colonizing an island, developing a high incidence of a…
A: The population is the group of individuals belonging to the same species and able to interbreed.…
Q: The team would now like to establish the smallest possible deletion that would inactivate the…
A: Amino acid monomers form the building blocks of proteins. The arrangement of amino acids makes up a…
Q: In a large, randomly mating population of frogs, the frequency of the allele for silver skin (s) is…
A:
Q: Cancer cells need more DNA synthesis but the NADPH/ NADP* ratio is high. Which of the following…
A: Cancer cells are abnormal cells that divide uncontrollably and have the ability to invade other…
Q: Analysis of a mRNA sample showed that 18% of the nitrogen-base molecules present were uracil…
A: due to time constraints we will be answering your first question here, please ask the second…
Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac…
A: Annotating a genome involves finding functional components throughout its sequence in order to give…
Q: Drugs and other medecine uses the concept of signaling. Cite some drugs how they mimic natural…
A: Many drugs mimic cell signalling molecules thereby stimulating cell function and compensate for…
Q: our short answer should be 2-5 sentences depending on the question. (Ch. 50). Please answer both…
A: The several kinds of sensations that humans are capable of perceiving are used to guide our motor…
Q: Briefly describe how the transcript beginning at the lambda PRe promoter can inhibit expression of…
A: The Cro protein is an effective and specific repressor of the RNA synthesis from the N and the cro…
Q: What color is the alpha gene spot on the microarray? Answer: Yellow please explain why is the…
A: The microarray can be described as a lab-on-a-chip. It can be used to detect the expression of…
Q: Instructions Explain 1 way each of the following can occur. In your answer, say whether non-…
A: the sperm carries Y, so non-disjunction occurs in mother, If the X chromosomes failed to separate…
Q: How we adapt & respond to new environments changes - hint shift away from bio The distinctions…
A: A morphologic, physiologic, or behavioral characteristic of a creature which enables it to coexist…
Q: Describe the difference between the terms INFECTION and DISEASE. Starting with exposure to…
A: Pathogens are essentially any germ or organism that lives in the bloodstream of an infected person…
Q: Snowy owls are large white birds that normally inhabit the cold northern regions of Canada.…
A: 1. As the food web shown in figure is interconnected, many species will be affected by introduction…
Q: 1. You are a lead engineer in a cGMP facility that develops and delivers tissue engineering…
A: Globally, myocardial infarction (MI) is one of the leading causes of death. Loss of cardiomyocytes,…
Q: What enzyme uses phosphocreatine to make ATP? creatine kinase phosphorylation. oxidative What other…
A: What enzyme uses phosphocreatine to make ATP? ans. Creatine kinase What other ways can we make ATP?…
Q: 5 Multiple Choice Provided below is a dichotomous key for determining the kingdom of an organism. 1a…
A: Answer : a unicellular organism that lives in pond and lacks nucleus would be classified as a member…
Q: ELODEA IN THE AQUARIUM WATER FROM CONTAINER Draw what the Elodea cells looked like when placed in…
A: Aquarium water is hypotonic compared to the cytoplasm of Elodea cell.
Q: how the Dual-energy-X-ray absorptiometry(DXA) and hydrostatic weighting to estimate the percentage…
A: Dual-energy-X-ray absorptiometry (DXA) for measurement of fat. DXA determines not only the precise…
Q: Which of the followings statements are true about DNA polymerase? 1.) It can only go in one…
A: DNA polymerase is an enzyme that plays a key role in the replication of DNA. It catalyzes the…
Q: Which one of the following statements about gap junctions or electrical synapses is incorrect? A.…
A: Electrical coupling is the transfer of coordinated action potentials from one cell to the next via…
Q: Tick all the essential steps to demonstrate a genetic linkage between a disease and a molecular…
A: Genetic linkage is the tendency of certain genes to be inherited together due to their location on…
Q: Which of the following features is NOT a characteristic of ALL animals? Self-propelled movement…
A: Introduction:- Living Organisms are classified into various groups on the basis of presence or…
Q: Which of the following is part of the extracellular matrix? A) All of the other answers are correct…
A: The fundamental building block of all living things is the cell. The trillions of cells that make up…
Q: What bacteria is growing on this nutrient agar?
A: Introduction there are several growth medium available for the growth of specific bacterial colonies…
Q: Some Traits in Garden Pea Plants In pea plants, the genes for seed shape, seed colour, and plant…
A: The method GREGOR MENDEL described as a cross to identify the hidden characters is known as a…
Q: Which one species is K-selected, not r-selected? Dandelion O Elephant O Guppy O Rabbit
A: Compared to r-selected species, k-selected species have relatively stable populations and generate…
Q: adolescence, the number of red blood cells _____ in _____. a. increases; both girls and boys b.…
A: Red blood cell production mainly occurs in the bone marrow. The main stimulant that helps in the…
Q: Name an organism that can cause a disease in each of the three systems we have most recently…
A: Introduction:- Disease is a type of disorder that affect the physical, mental and emotional well…
Q: Steps to becoming human identify and describe each step and the are looking for in the fossil…
A: Anthropology is the study of human behaviour and societies in the past and present. It includes…
Q: can you please label on the image i have provided
A: The nucleus is present within the cell and constitutes chromosomes. Connective tissue is responsible…
Q: Which of the following is part of the extracellular matrix? Group of answer choices A) All of the…
A: The extracellular matrix fills the spaces between cells and binds cells and tissues together. It…
Q: A parent has the genotype PpLl for two independently assorting genes. What are all the possible…
A: According to Mendel's independent assortment law, the parent who has the genotype PpLl for two…
Q: Describe Scientific Method
A: A research proposal is a document that specifies the aims of the research and the techniques that…
Q: What materials used for bioprosthesis heart valves (the chemically pretreated heart valves)?
A: Prosthetic valves are used to replace diseased or non-functional or dysfunctional heart valves. It…
Q: What generally happens to individual expenditure(private meaning for the individual person, not the…
A: To make health for all a reality, there is a need of individuals and communities who have access to…
Q: 1. You are a lead engineer in a cGMP facility that develops and delivers tissue engineering…
A: Injectable engineering solutions must be capable of supporting LV wall and avoid post myocardial…
Q: Why do we study primates? Why is it important to study human evolution?
A: The study of anthropology is a broad one and covers a variety of topics. In its most basic form,…
Q: Eukaryote cells are living cells that are specialized to deal with changes in the external…
A: Introduction: When a cell wants to engulf something, it binds to it on the cell surface and draws it…
Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…
A: Introduction The process by which a gene's information is used to produce either RNA molecules that…
Q: 1) Compare and contrast population ecology, community ecology, and ecosystem ecology
A: Ecology derives from the Greek terms for "HOUSE" and "DISCUSSION/SPEECH," OIKOS LOGOS. The planet is…
Q: http://www.treeboss.net/tree-trunk-splotches.htm downloaded 21 March 2012 Q12. What do you think it…
A: This activity is about different types of living beings which have different characteristics such as…
Q: Describe what occurs when a person experiences a chickenpox infection, including the cause, the…
A: Please follow steps 2 & 3 for detailed explanation.
Q: 1. Who are at risk of having TB infection? (Tick the appropriate box) Risk group: HIV infected…
A: Some infectious pathogens can present in the air for longer periods of time. These microorganisms…
Q: Define what a pneumonia is, including what tissues are involved and what the consequences are for…
A: A bacterial, viral, or fungal infection of the lungs is known as pneumonia. Alveoli, the air sacs…
Q: Oscillatoria is a thread-shaped Cyanobacteria, while Spirogyra is a thread-shaped Protist. Make a…
A: Green algae and cyanobacteria are two photosynthetic organisms derived from algae. They are both…
Q: Use the following information to answer the next question. Life Cycle of a Butterfly Adult…
A: Nondisjunction in meiosis II comes from the failure of the sister chromatids to split during…
Q: Question 24 Proximal tubule balance is a passive process that explains increased sodium and water…
A: The filtered load of all solutes, including glucose, amino acids, and other solutes absorbed by Na+…
Q: Briefly explain the alternative communication systems in early childhood education or classroom.…
A: Children who have trouble hearing or speaking benefit from alternative communication. Children that…
Q: Do you think it's ethically allowed to use genetics to fix a heart disease? Why and why not. Your…
A: Ethical issues related to the use of genetic technologies include potential privacy breaches,…
Step by step
Solved in 2 steps
- What are soil borne diseases and how to control them?How do Biofertilisers enrich the fertility of soil? How does cyanobacteria acts as biofertiliser?All of the following are true about soil microorganismsEXCEPT:(a) They never affect or change the physical characteristicsof their soil microenvironment.(b) They are considered to be a part of the soil.(c) All major microbial taxonomic groups can be found insoil (bacteria, fungi, algae, protists, viruses).(d) Species of the genus Clostridium contain important hu-man pathogens found in soil.(e) They are important as decomposers in the carbon andnitrogen cycles.
- What are the social and economic implications of using microbial plastics? What are the social and economic implications of applying bioremediation to pesticide-contaminated agricultural lands?Answer the following questions below: 1. What is soil microbiology? Why is it important to study soil microbiology? 2. Explain biogeochemical cycle! Discuss extensively 1 example of biogeochemical cycle and give its importance. 3. Discuss the contribution or applications of microoragnisms in solid waste management and in sewage treatment. Give examples to strengthen your discussions.Explain why most microorganisms are present in the upper layers ofthe soil.