Q: Proteins trafficked to the nucleus arrive ____. In the mitochondria, proteins are trafficked in a…
A: Introduction The biological process by which proteins are delivered to their proper locations…
Q: The _____________ plants died, partially decomposed, and became the fossil fuels? (choose all that…
A: Sphagnum Moss: There are over 380 recognised species of mosses in the genus Sphagnum, which is also…
Q: Changes to the nucleotide sequence in the primary transcript (pre-mRNA) may lead to an error in…
A: * Transcription is the process in which mRNA will be made from DNA . *The end product of…
Q: Antonie van Leeuwenhoek was the first person to use a microscope and describe tiny animalcules. What…
A: Introduction : A microorganism is an organism too small to be seen by human naked eyes.…
Q: State 3 important results of meiosis.
A: Dividing phase of a cell cycle is the phase of actual division. ON the basis of cell type in which…
Q: How does bulk transport of molecules governed in a eukaryotic cell?
A: Bulk transport mechanisms are required in cells to move large particles (or large quantities of…
Q: Upper Intertidal Zone Lower Intertidal Zone Balonus kalenvides Chthamalus scellatus The diagram…
A: Introduction: Connell is an American ecologist, but because his research on how interspecific…
Q: Answer it. In Seminal Fluid Analysis, what are aspects of semen that are assessed microscopically?
A: Sperm The male gamete that is motile and fertilize female gamete.
Q: Which pair of amino acids is charged, polar, and has an amino group on its side chain? a)K, R b)N,…
A: Amino acids:- it is usually acts as building block of peptides and proteins. But, a lot of amino…
Q: Traits can be described as quantitative or qualitative. Are only quantitative traits polygenic?…
A: As per our guidelines we are not allowed to answer more than one question at a time please ask next…
Q: Which word best describes the image illustrated? P m tetrad staphylococcus Opalisades…
A: Bacteria They are prokaryotic unicellular organism which may be beneficial or harmful to human being…
Q: Link each term with the correct definition.
A: Evolution is the gradual change in the inherited traits of natural populations over many…
Q: PDB could assist Dr. in her research endeavor. Explain how
A: Bioinformatics relates to the approach of using computer-related databases and algorithms to…
Q: 3. We discussed seven points regarding the attributes of life. What are the 7 points and how do they…
A: Introduction:- Living organisms are made up of cells that performs the basic functions of life like…
Q: Explain the three stages of cell signaling. a. receptor b. transduction c. response. Attach images
A: Introduction:- Cell signalling is a very important function of a cell because it allows a cell to…
Q: Answer the given situation below; a. Bob says that he is healthy and has no genetic diseases such as…
A: Introduction: Genes are a set of instructions that determine what the organism is like, its…
Q: Describe a series of experiments to SELECT and/or SCREEN for strains containing mutations that…
A: There is a chemical called styrene which is used in many industries to make latex, polystyrene…
Q: In a population, which individuals are most likely to survive and reproduce? (a) The individuals…
A: Population means individuals of people of the same species living in the same environment or area.…
Q: What happens if plasma membrane fails to maintain optimal fluidity? • Describe structure/function of…
A: * plasma membrane is the envelope like structure that surrounds the cell and its organelles . *It is…
Q: What forces drive solutes from one side of the membrane to the other? • What solute properties…
A: Introduction: Because they control which chemicals can pass through and how much of each material…
Q: If the two populations in question 2 are determined to still be the same species, did allopatric…
A: The mechanism through which populations develop into different species is known as speciation. In…
Q: A prokaryotic cell _______ contain lysosomes. A prokaryotic cell _______ contain golgi. Select one:…
A: Prokaryotic cell The cell is the fundamental , structural and functional unit of living organisms.…
Q: 4. There are two principles underlying gel electrophoresis: charge, and the use of a gel matrix.…
A: As per our guidelines we are supposed to answer only ? One question ( if there are multiple…
Q: In one sentence each, identify the similarities and the differences between artificial selection and…
A: Any accumulated or cumulative change in an organism's or population's features over a long period of…
Q: Using cable theory to describe axon conduction would tell us a. the larger the diameter of the axon…
A: In an ion cascades, action potentials move along neuronal axons. Transmembrane pathways near the…
Q: Which of the following would inhibit the function of the JAK-STAT Pathway? Multiple answers A.…
A: JAK-STAT pathway is activated in response to cytokines (interferons and interleukins). The receptor…
Q: Gram staining is a common technique used to differentiate two large groups of bacteria based on…
A: Answer: Gram staining technique : It is the staining technique which is used to differentiate…
Q: All mammals have tailbones and muscles for moving a tail. Even humans have a reduced tailbone and…
A: Evolution is the gradual progression in the inherited traits of natural populations over many…
Q: How does bulk transport of molecules governed in a eukaryotic cell? by active transport by…
A: Bulk Transport Across Cell Membranes Bulk transport inwards as well as outwards occurs across the…
Q: Suppose the prevalence of HIV is 0.3% in the population of 500,000 blood donors for your…
A: Below I am attaching a image pls go through it.
Q: Describe critical concentration (Cc) • Describe actin/microtubule polymerization • Contrast “T” and…
A: Cytoskeleton is complex network made up of microtubules, intermediate filaments and actin filaments.…
Q: Which of the following would be the least desirable model species to learn how proteasomes govern…
A: Model species:- model organisms or species are those which can be easily handled and breed well in…
Q: The percentage of time spent at different physical activity intensities is the same for boys and…
A: Introduction An exercise's difficulty is determined by its intensity, which is often based on how…
Q: Match the shorter sequence relative to the longer one. Note: Observe Chargaff's rule of base…
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms that is composed of…
Q: . Explain the cell theory
A: In 1665, Robert Hooke became the first scientist to identify the cell. Hooke observed a swarm of…
Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU
A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…
Q: A population consist of 7 mice. For the coat trait, there are only two alleles: brown B and white…
A: Introduction: The alleles are the alternative forms of a gene that are located on the same locus of…
Q: Low Medium Magnifying power High Ocular Objective 10 10 40 100 Prepared slides The diameter of the…
A:
Q: Answer the question below based on your own understanding; Why do you think all organisms use…
A: DNA and RNA both of them are nucleic acids but When genetic information is transmitted, DNA and RNA…
Q: Which of the following statements is TRUE about phospholipids?
A: Phospholipids are mainly found in cell membranes. They are a combination of a lipid molecule and a…
Q: Calculate the total number of bacteria in your yogurt container three times (in duplicate). Begin by…
A: Colony forming unit: A colony-forming unit is used to determine the number of viable microbial…
Q: Lipoproteins like LDL and HDL transport lipids and proteins through the blood stream. Receptors on…
A: Lipoproteins are complex particles with a central core containing cholesterol esters and…
Q: Assume that short ear lobes in humans are an autosomal dominant trait that exhibits 60% penetrance.…
A: The unit of heritance which carries information from one generation to the next is called genes.…
Q: DNA sequences were analyzed from humans and three other mammals: species X, Y, and Z. Which of these…
A: DNA is stands for deoxyribonucleic acid. DNA is genetic material that is present in each cell of…
Q: Rehpogs are mythical creatures. They are small and not very smart. Rehpogs live on the ground in a…
A: Introduction Inheritance patterns are of different type’s Mendelian inheritance, incomplete…
Q: Figure 7.2 If a mutation occurs so that a fungus is no longer able to produce a minus mating type,…
A: Fungi is a kingdom of eukaryotic organisms that include microbes like yeast and molds and differ…
Q: About _____% of the variance between physical activity levels in humans is due to genetic variation.…
A: Taking care of fitness immediately allows us to be productive and provides us stamina and…
Q: Many fossils existed in one layer of rock, but not in others from different time periods and this…
A: A fossil is the mineralized partial or entire shape of an organism, or of an organism's pastime,…
Q: Please answer fast What is "variable penetrance"? Explain why autosomal dominant disease penetrance…
A: Autosomal disease The disease which is caused by the autosomal set of chromosome except the X and Y…
Q: Lipoproteins like LDL and HDL transport lipids and proteins through the blood stream. Receptors on…
A: A lipoprotein is a biochemical assemblage whose main job is to move fat molecules in water that are…
Animal Diversity
Nematodes are commonly known as roundworms. They are free-living, very tiny organisms. They have an elongated and tubular body. These organisms have a nervous system and are mostly act as parasites to both animals and plants.
Platyhelminthes
Platyhelminthes are also known as "flatworms" because as they are dorsoventrally flattened from head to tail. They are invertebrate, soft-bodied, acoelomate, unsegmented and have bilateral symmetry.
What are the distinct characteristics of the reduviid bug, tse-tse fly and sandfly?
Step by step
Solved in 2 steps