Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: 5. Construct a gene map given the following information Which two genes are most likely going to be ...
A: Genes are present in the cells of an organisms. Cells are the basic units of the organism that const...
Q: 1. identify and describe the basic structures forming the digestive, respiratory and circulatory sys...
A: Homeostasis is the state of equilibrium inside a system that allows it to function under a range of ...
Q: 4. Thomas Morgan collected the following crossover gene frequencies while studying Drosophila. Bar-s...
A: Cross over map: it is constructed by using cross over frequency. More the value of cross over freque...
Q: A catalyzed reaction requires more activation energy to proceed than one without a catalyst. True Fa...
A: The enzyme show catalytic property. They can't initiate or stop a reaction, but only accelerate the...
Q: Mendelian Genetics The presence of a dimple on the cheek is governed by a dominant gene. A couple h...
A: Heterozygous means that you acquired different versions of a gene from each of your parents. A heter...
Q: Explain what is meant by the term homologous chromosomes ?
A: Chromosomes are condensed forms of chromatin that are visible during cell division. They were found ...
Q: Which of the following best explains the leading daughter DNA strand? The leading strand is synthes...
A:
Q: distinguish between bacterial cells that obtained the plasmid and those that did not
A: Bacteria are single celled organisms with a unique internal structure.
Q: What role does understanding the origins of the insect alimentary canal have in comprehending each d...
A: INTRODUCTION In insects, their digestive system make their nutrients and other sources of s...
Q: Under which scenario can a hawk successfully invade (or persist among) a population of doves? Grou...
A: The evolutionarily stable strategy, often known as the Hawk-Dove Game hypothesis, is a famous exampl...
Q: What is true about the phosphorylation of ADP? O a) A phosphate group is added b) It is an exergonic...
A: ATP is the molecule that is responsible for releasing energy during hydrolysis. It provides necessar...
Q: How Small Noncoding RNAs Play Regulatory Roles in Bacteria ?
A: Small RNAs (sRNAs) influence gene expression via base pairing with mRNA after transcription. The int...
Q: For each of these things, say whether it describes the coding sequence or the regulatory sequence. T...
A: Coding sequences are sequences or portions of a gene or mRNA which codes for a protein. The coding r...
Q: How can reverse transcriptase inhibitors slow the replication of DNA? Give an example that layperson...
A: DNA, or deoxyribonucleic acid, is defined in the universal term that is a genetic substance found in...
Q: How does the MC1R gene affect skin color?
A: The skin coloration depends on various genes and complicated cell signalling processes. Different mo...
Q: enzymatic activity. Which of the following procedures might help you to obtain soluble, enzymaticall...
A: Introduction: Genetically modified organisms are those in which genetic engineering techniques are u...
Q: OBasophils O Macrophages
A: Phagocytic name is come from the greek work phagein that means to eat and 2nd word is cyte . phagoc...
Q: 1b. If the undertermination thesis is false, then scientific theories can be deduced from observatio...
A: Undetermination thesis It is a thesis that states that for each scientifically established hypothesi...
Q: Which of these statements best demonstrates the difference between the action of B cells and T cells...
A: B cells secrete antibodies that contribute to tissue injury via multiple mechanisms. In addition, B ...
Q: 2. Define resolution and state why is it important in distinguishing magnified objects
A: Microscope is used to see and analyse objects/organisms that cannot be seen with normal eye. In biol...
Q: environment
A: Insects adaptations include mouth parts, the ability to fly,leg types and body shapes... They die, t...
Q: If the MRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3', then what is the corresponding...
A: Transcribing tRNA from mRNA, mRNA tRNA U A G C A U C C The above table can be used for...
Q: Describe the smaller and largest living unit of nerve cells
A: "The nervous system" of all animals is made up of unique cells known as neurons, which serve as the ...
Q: Explain about the mechanism of genotoxic agent in validating the regulator histone h4 dosage modulat...
A: Introduction: Candida glabrata is a yeast that is haploid. C. glabrata is a common bacterium found i...
Q: Phosphate head of phospholipid bilayer is hydrophobic in nature. True False
A: Since you have asked multiple questions , we will solve the first question for you. If you want any ...
Q: What is the underlying molecular mechanism of action for the antibiotic novobiocin?
A: Novibiocin is an antibiotic produced by the fungi belongs to actinomycete class which is Streptomyce...
Q: DNA polymerase III adds nucleotides to both ends of the RNA primer to the 5' end of the RNA primer
A: DNA is the genetic element found in all prokaryotic and eukaryotic cell types. DNA is a double-stran...
Q: Sexual adjustment is best viewed as a relationship issue, not just one partner’s problem. T or F?
A: Human beings are social animals. The first man on Earth was a cave man. No societal rules and regula...
Q: Which of the following statements regarding enzyme function is false? U A) An enzyme's function depe...
A: Enzymes are proteins which can act as a catalysts. They can decrease the activation energy needed ...
Q: there is a type of epithelial tissue called pseudostratified. Why?
A: The tissues associated with enveloping human body’s exposed surfaces can be described as the epithel...
Q: ical reaction, the are converted to products. Select all that apply. reactants J enzymes O catalysts...
A: A chemical reaction is a process in which one or more substances called reactants are converted to o...
Q: PROBLEM The following data were obtained from the thyroid uptake study of a patient after administra...
A: thyroid uptake is the method via which the radiologist determines the thyroid function in the patien...
Q: 1. Based on the given RBC Histogram, answer the following questions given below: FIGURE A - NORMAL F...
A: *The RBC histogram is a graphic representation of particle size distributions and blood counts. *Th...
Q: Explain the main regulator being evaluated in the article histone h4 dosage modulates DNA damage res...
A: Histone H4 is a key protein in the structure and function of chromatin, and its sequence variants an...
Q: he following data were obtained from the thyroid uptake study of a patient after administration of I...
A: According to the data provided, the percentage of thyroid uptake of the patient after administration...
Q: What are the roles of ATP and NADPH in photosynthesis?
A: Photosynthesis is a process that plants and other living things use to convert light energy into che...
Q: Which of the following is considered as an appropriate plant extraction technique? 1. Thermolabi...
A: The basic steps of extraction are:- penetration of solvent into a solid matrix dissolution of solut...
Q: ch below with axygen level and function for each heart section. Function: Only identify where the bl...
A: Heart: it is an organ that pump the blood across the body via vascular system. Vascular system: it ...
Q: On Monday, the average blood glucose of 10 humans before ingesting 50 grams of pure glucone was foun...
A: Solution:- Glycaemic index (GI) is a scale which is used to rank the carbohydrate consisting food. T...
Q: Question 16 Select all answer(s) that apply: In colonial times the passenger pigeon population of th...
A: The Passenger Pigeon was one of the most common migratory birds in the 19th century but it went exti...
Q: How is UV exposure an example of phenotypic plasticity
A: The ability of a genotype to express different phenotypes depending on its environment is referred t...
Q: Please answer fast What are two of the four types of tetrads that come from yeast sexual reproducti...
A:
Q: Oxygen gas is a by-product of non-cyclic electron flow. How/why is it produced? Would a photosynthet...
A: Photosynthesis It is the process used by plants to convert light energy from sunlight to chemical en...
Q: what is considered to be one of the most successful environmental agreement of all time and what is ...
A: According to many kinds of research and data's Montreal protocol is one of the most successful envir...
Q: How is physiological insect defensive mechanisms carried out by the insect circulatory system? Does ...
A: Circulatory system in insects- The circulatory system of insects, like that of all arthropods, is of...
Q: A mass in the adrenal gland was found incidentally on a CT scan in a 40-year-old male patient. True ...
A: Adrenal glands are situated above the renal gland and so the name. It is a small gland which makes s...
Q: You are a genetic counselor, and you received the following pedigree to analyze. You must determine ...
A: Generation 3 is.... 1. Dd 2, 3,4,5,6.. is dd Genotype.
Q: ENUMERATE. The capabilities as a swimmer or capabilities to become a good swimmer?
A: Swimming is indeed an useful and enjoyable way to remain in shape. It has numerous health benefits, ...
Q: 4. Thomas Morgan collected the following crossover gene frequencies while studying Drosophila. Bar-s...
A: If the genes are located on the same chromosome then they are classified as linked genes and they wi...
What are the functions of the cardiovascular system?
The cardiovascular system consists of the heart, blood vessels, and blood. Its primary function is to transport nutrients and oxygen-rich blood to all parts of the body and to carry deoxygenated blood back to the lungs.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
