What is the best anticoagulant for blood? Explain

Q: Xanthoproteic test is used to detect amino acids containing an  aromatic nucleus in a protein…

A: Introduction  Organic substances known as amino acids have both functional groups for amino and…

Q: What is the evolutionary advantage of bacteria that have flagella vs. bacteria that do not?

A: Flagella is a hair-like structure found in many microorganisms (including bacteria) that allows them…

Q: Describe the process of meiosis

A: Introduction: Mitosis and meiosis are the two distinct processes of cell division. The cell division…

Q: What specific reaction cannot occur due to the presence of cyanide? A.Transfer of electrons to…

A: Correct answer is option C Cyanide is suppose to be the poison as it interrupt the electron…

Q: Why is it beneficial to have Fc receptors on phagocytic cells?

A: A Fc receptor is a protein that is present on the surface of a number of immune system-supporting…

Q: E. it can be used on hair and In anaerobic fermentation pyruvate is further oxidized to lactate or…

A: During aerobic respiration, by the process of glycolysis glucose molecule is broken down into form…

Q: Molecules transported in the fast phase of axoplasmic transport are:  Select all correct answers.…

A: Axoplasmic transport occurs in neurons. It is the transport by which proteins and other substances…

Q: DNA structure and its 3 chemical components

A: DNA is the genetic material in living organisms that contain genes which determine the…

Q: Which of the following is true? a. A dominant allele is more common than a recessive allele b.…

A:

Q: Viruses are composed of which type of genetic material inside of a protein shell? a. Not all…

A: Introduction :- Large biomolecules and macromolecules known as proteins are made up of one or more…

Q: 5:00 Which of the following is NOT found in the indicated region of a spermatozoon? S A) DNA C)…

A: We know that Sperm is the male gamete that is produced by spermatogenesis in the testes. They…

Q: __________ is a biological phenomenon, while __________ is a socially constructed phenomenon. 4. A…

A: In humans sex determination is done based on the presence or absence of Sex chromosomes "X" and "Y".…

Q: True or False: (T/F) Physical forces acting on the thorax and wing hinge during flight are detected…

A: Insects have flight muscles attached directly to their wings. Flight muscles move the wings…

Q: Discuss the metabolic changes that take place in aspirin. How can it cause methemoglobenemia?

A: Introduction :- Aspirin belongs to a class of drugs known as salicylates. It functions by preventing…

Q: Cytokinesis is part of telophase I Otelophase II Omitotic phase interphase mitosis s-phase

A: Cell division occurs physically through a process called cytokinesis, in which a parent cell's…

Q: REPORT SECTION Name: F. Fruits and Dispersal Day & Hours of Lab Section: 1. Complete the table below…

A: Mechanism Of Fruit And Seed Dispersal Winds Devices such as the wings , hairy , poppus and…

Q: Most of the time of the cell cycle is spent in prophase s-phase mitosis anaphase II none of the…

A: Introduction :- A cell's growth and division are accompanied by a sequence of processes known as a…

Q: If proteases such as pepsin and trypsin digest protein, why do not they digest the stomach and small…

A: Break down of carbohydrate starts in buccal cavity by salivary amylase. first digestion of protein…

Q: What are three functions of the cell nucleus?       What are two functions of a plant cell vacuole?

A: Introduction: Nucleus: The largest and most noticeable organelle inside the cell is the nucleus. The…

Q: This cell is in what stage? Interphase Prophase Metaphase Anaphase Telophase

A: Genes that are sufficiently close together on a chromosome will tend to "stick together," and the…

Q: How this picture demonstrates people helping to maintain biodiversity?” What these people are doing?…

A: Aquatic biodiversity is crucial to sustaining and preserving the general health of the environment…

Q: What do you understand by “Sequencing by synthesis?” What is FRED score? Give an example.

A: Introduction: The complete DNA sequence of a human being is known as their genome. There are 46…

Q: Briefly explain how multi factorial variables in the environment act concurrently

A: A set of observations, each described by several different sets of variables, is subjected to…

Q: why are the steps in gram staining are so carefully standardized?

A: Gram staining is very useful process that differentiate bacteria on the basis of their cell wall…

Q: Draw a thylakoid disc. Label the following components: Thylakoid membrane Thylakoid space (lumen)…

A:

Q: The difference between asexual and sexual reproduction is that O A. asexual reproduction occurs only…

A: The generation of descendants can be referred to as reproduction. Asexual reproduction is one of the…

Q: Explain in your own words what is the environmental significance of pH.

A: pH is a very important tool for assessing the acidity or alkalinity of a substances.

Q: what happens if the chromosomes within an individual are not tightly packed. How does this affect…

A: Chromosomes are made up of a DNA-protein complex called chromatin that is organized into subunits…

Q: Name ten examples of bacteria and give their colony morphology. ( indicate the media used for each)

A: Scientists utilize a technique called colony morphology to define the properties of a specific…

Q: Muffy, a color blind female with blood type A (heterozygous to type O) is married to Biff, who is…

A: Given: Muffy, a color-blind female with blood type A (heterozygous to type O), married to Biff, who…

Q: An individual with an energy expenditure of 30 L of O2/mile and an RER of 0.2 would have to run how…

A: There is a non-linear courting among strolling pace and price of calorie burn. Essentially what this…

Q: airways clean. Oribosomes Ocell walls O cilia vacuoles microvilli present on the cells of our…

A: Trachea is a long tube that connects your larynx ( voice box) to your lungs . Trachea is often…

Q: During staining, the first step is to dewax the slide. What is the purpose of the step? What is the…

A: Introduction :- In microscopy, staining is a technique used to increase contrast in a microscopic…

Q: Which of these organelles is directly involved in the synthesis, editing, or modification of cell…

A: The science of cell structure and function is known as cell biology, and it is based on the idea…

Q: ►Describe the effects of enzyme concentration on enzyme activity

A: Every step in the biological process depends on enzymes. They catalyse the sequential reactions…

Q: Visit www.mayoclinic.org to learn more about the gallbladder's role in fat breakdown. What dietary…

A: The dietary suggestions following gallbladder removal. 1. For at least a week following surgery,…

Q: Match description with Term:   1) determine the amount of protein in a sample 2) determine the…

A: Recombinant DNA technology is a method by which several different genes can be combined from two…

Q: The human genome is distributed among ____ pairs of chromosomes:   a) 21 b) 22 c) 23 d) 24

A: Chromosomes are thread like structures made of protein and single molecule of DNA that carry all the…

Q: Vaccine mandates are often justified as necessary to protect public health (and do the most good for…

A: In order to understand what is ethically wrong or right, ethics explores the intellectual…

Q: How is an antibody used to eliminate a pathogen?

A: An immunoglobulin or antibodies are large, Y-shaped blood proteins, which are generated by plasma…

Q: Discuss how global warming might make it harder for the wind/currents to mix the different ocean…

A: Methane gas is produced by microorganisms that break down plant and animal material. This is a…

Q: Types of life-threatening arrythmias in adults

A: Arrhythmias is generally due to very low potassium or magnesium or it is  associated with…

Q: What is the biological basis that an Indian woman at the age of 74 gave birth to a child?  Is this…

A: Human development demands the right environment, the right conditions, the right time, and a lot of…

Q: If a human gene is found to contain five introns, the mature mRNA encoded by that gene would have…

A: Introduction  The parts of a gene that are translated into proteins are called exons. Introns are…

Q: why is sleep so important? How does the lack of sleep affect the brain negatively?

A: Sleep is a natural process of the body or reversible state of mind characterized by loss of…

Q: Experiment # Growth Condition plus 0₂ minus 0₂ plus O2, plus cyanide* 1 2 3 cyanide stops the…

A: Cellular respiration is a multistep metabolic pathway involving the metabolism of glucose in the…

Q: 345 bison is wandering and grazing in an area where there is an old bridge across a river leading to…

A: 1 2 and 3  Bottle neck affect is an extreme example of genetic dtift that happens when the size of a…

Q: Compare and contrast the origins and functions of miRNA and siRNA

A: All living cells contain ribonucleic acid, a nucleic acid with properties comparable to those of…

Q: Given in the photo is a family that has a history of phenylketonuria (PKU). Couple 1 Couple 2 PKU…

A: Genes Genes are the sequence in the DNA that code for perticular enzyme or protein.

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Hematology

Hematology is the branch of biology. Hematology is the medical field that deals with the treatment of blood disorders and cancers, such as hemophilia, leukemia, lymphoma, and sickle-cell anemia. Hematologists and hematopathologists are medical professionals who specialize in illnesses of the blood and its components.