What is the BEST explanation for why DNA replication is discontinuous at the lagging strand? А. DNA helicase has to unwind the DNA at several locations before synthesis can take place. В. DNA replication is dispersive and discontinuous. С. DNA polymerase can only synthesize DNA in the 5'-3' direction. D. DNA polymerase requires multiple RNA primers for synthesis to take place. Е. DNA polymerase can only synthesize DNA in the 3'-5' direction.

What is the BEST explanation for why DNA replication is discontinuous at the lagging strand? А. DNA helicase has to unwind the DNA at several locations before synthesis can take place. В. DNA replication is dispersive and discontinuous. С. DNA polymerase can only synthesize DNA in the 5'-3' direction. D. DNA polymerase requires multiple RNA primers for synthesis to take place. Е. DNA polymerase can only synthesize DNA in the 3'-5' direction.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 12TYK: Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to...

See similar textbooks

Similar questions

What is the basis for the difference in how the leading andlagging strands of DNA molecules are synthesized?(A) The origins of replication occur only at the 5′ end.(B) Helicases and single-strand binding proteins work at the5′ end.(C) DNA polymerase can join new nucleotides only to the3′ end of a pre-existing strand, and the strands areantiparallel.(D) DNA ligase works only in the 3′ S 5′ direction
Which statement about Okazaki fragments is true? Select one: a. DNA polymerase doesn’t need a primer to build these fragments b. They act as a primer that initiates DNA replication. c. They correct errors made during earlier phases of DNA replication. d. They are necessary because DNA polymerase can only build DNA in the 5’ to 3’ direction, so for one of the strands at each fork, the DNA polymerase can only buildaway from the fork. e. They prevent the ends of chromosomes from shortening with every replication.
Which of the following statements are correct? explain your answers.a. a bacterial replication fork is asymmetrical because it contains two DNA polymerase molecules that are structurally distinct.B. okazaki fragments are removed by a nuclease that degrades RNA.c. the error rate of DNA replication is reduced both by proofreading byDNA polymerase and by DNA mismatch repair.d. in the absence of DNA repair, genes are unstable. e. none of the aberrant bases formed by deamination occur naturally in DNA.F. cancer can result from the accumulation of mutations in somatic cells.
Regarding the process of DNA replication, it is correct to state that: a) Nucleosomes are maintained during the DNA polymerase-mediated replication process b) The phosphodiester bonds that join the nitrogenous bases maintain the integrity of the DNA strands c) DNA polymerase requires a previously annealed deoxynucleotide to add the next monomer being synthesized. d) The action of the helicase decreases the twist caused by the movement of the replication complex along the stretch of DNA e)
Which of the following statements is FALSE regarding the molecular mechanism for DNA polymerases? A. The active site contains 2 divalent metal ions B. A single stranded DNA template is required C. The enzyme can only attach a new deoxynucleotide to the 5’ end of a growing chain D. The 3’OH on the deoyxyribose ring attacks a phosphate of a dNTP to produce a new phosophodiester bond E. None of the above (all are true statements)
What is the difference between the leading strand and the lagging strand in DNA replication? a There are different DNA polymerases involved in elongation of the leading strand and the lagging strand. b The leading strand is synthesized continuously in the 5' → 3' direction, while the lagging strand is synthesized discontinuously in the 5' → 3' direction. c The leading strand requires an RNA primer, whereas the lagging strand does not. d The leading strand is synthesized in the 3' → 5' direction in a discontinuous fashion, while the lagging strand is synthesized in the 5' → 3' direction in a continuous fashion.
What is the basis for the difference in how the leading and lagging strands of DNA molecules are synthesized? a. The origins of replication occur only at 5'end b. Helicases and single-strand binding proteins work at the 5'end c. DNA polymerase can join new nucleotides only to the 3' end of a pre-existing strand d. DNA ligase works only in the 3'-5' direction
You are studying a colony of cells and determine that some of these cells have a mutated DNA polymerase I that results in loss of function of this enzyme. A) What will the effect of the mutation in DNA polymerase I be on DNA replication? In your answer make sure to describe what would be observed in the leading and lagging strand and explain your reasoning. B) Will this mutation in DNA polymerase I have an impact on another step in DNA replication? In your answer make sure to indicate whether DNA replication will be impacted or not. If it is not, explain why. If it is impacted, then describe the step that is impacted and name the molecule or enzyme involved.
a) If you isolated DNA from the ear and the tail of the same mouse, would you expect the DNA, isolated from the two tissue types, to be the same? Why? b) Provide one difference between DNA replication in eukaryotes and prokaryotes with regard to their origin (s) of replication.
Why is DNA replication considered semiconservative? a. One molecule consists of the old strands and the other DNA molecule is entirely new. b.Both strands of each replicating DNA molecule are new. c. One strand of each replicating DNA molecule is conserved and the other strand is newly synthesized. d.Both strands of each replicating DNA molecules are conserved.
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
What was the significance of Meselson and Stahl’s experiments on DNA replication using the heavy isotope of Nitrogen? A. telomerase was identified as the molecule responsible for solving the end replication problem of eukaryotic chromosomes B. the existence of lagging strand synthesis was proven. C. the rate of DNA synthesis by DNA polymerase was measured D. the processivity of DNA polymerase was established E. the semi-conservative mode of DNA replication was confirmed