Q: 2. What cell structure make Mycobacteria particularly virulent and how? 3. What cell structures do w...
A: 2.Tuberculosis (TB), brought about by the intracellular microbe Mycobacterium tuberculosis, stays on...
Q: how does an organism maintains homeostasis through the interaction of the various organ systems in t...
A: Homeostasis, from the Greek words for "same" and "steady," refers to a self-regulating process by wh...
Q: Suppose a population has two alleles at a particular locus, and individuals with different diploid g...
A: Hardy Weinberg’s principle is the mathematical representation of population analysis which calculate...
Q: Miguel went to the dentist, who performed a procedure that eliminated his tooth pain. The next time ...
A: There is a relationship between the stimulus and the behaviour. Our behaviour can change according t...
Q: The part of the neuron that is usually highly branched and receives input from other neurons is the ...
A: Neurons are a particular form of cell that carry information messages or signals to and from the bra...
Q: define a single nucleotide polymorphism
A: Introduction:- Genetic polymorphism is the inheritance of a trait controlled by a single genetic loc...
Q: What are the developmental stages of Trypanosama? Describe how the stages appear
A: Life cycle of trypanosoma cruzei:- it involves two intermediate hosts : Triatomine insects and human...
Q: Define the following terms: Predator Prey Population
A: Introduction: Ecology is the branch of biology that deals with ecosystem (interaction between organi...
Q: Can the amount of available energy on a given trophic level be larger than the available energy on l...
A: The number of steps an organism has taken from the beginning of the food chain determines its trophi...
Q: What are the main types of waste?
A: Introduction Organic waste, recyclable waste, non-recyclable waste, toxic waste, nuclear toxic waste...
Q: In what ways are mitosis and meiosis different?
A: The fundamental and active biological process by which a parent cell, after replication of it's comp...
Q: A breeder performed a testcross to find out if his male dog was a purebred black. He got one brown p...
A: Introduction :- An experimental hybrid between an individual organism with a dominant phenotype but ...
Q: Label the tissues that form each layer, namely the columnar epithelium, reticular fibers, smooth mus...
A: In this photomicrograph i can't labelled the reticular fibre and loose CTP because of this image not...
Q: called the ______ and at least one thicker-muscled chamber that squeezes blood out of the heart: v__...
A: Circulatory system Heart is made up of chambers which function to pump blood and act as temporary re...
Q: Black body (b) and purple eye (pr) are recessive autosomal mutations in Drosophila. Bridges are cros...
A: b - allele for black body - recessive pr - allele for purple eye - recessive B - wild type for body ...
Q: If you were studying mutant rabbits which seem unable to sense and move away from a harmful heat sou...
A: Receptors are present on the sensory organ that sends the message to brain via nerves.
Q: If Marine communities dominated during the Early Paleozoic, why move to land? What would an organis...
A: Paleozoic era was a major interval of geologic time that began 541 million years ago and ended about...
Q: Sketch one photosystem. Label the light-harvesting complex, reaction center chlorophyll, and primary...
A: Introduction : Photosystem II / PSII is present in stacked region of thyllakoid. PSI and ATP synth...
Q: Aside from Dengue Fever what other diseases can Aedes aegypti carry
A:
Q: The placenta is your unborn baby's life support system and plays a key role in its development. Ans...
A: The placenta is a vital organ that plays a crucial role in fetal development. Without it, the fetus ...
Q: What are the stages of cellular respiration in which catabolism of sugars, glycerol, fatty acids, an...
A: Glycolysis, pyruvate oxidation, the citric acid or Krebs cycle, and oxidative phosphorylation are al...
Q: Define single nucleotide polymorphism (SNP), restriction enzyme, cathode, anode, agarose, well, and ...
A: All these are components are used in gel electrophoresis Gel electrophoresis is a technique in whic...
Q: 21. What are two ways by which SARS-CoV-2 disguises itself from detection by its host-cell's immune ...
A: SARS CoV 2 is a RNA virus, members of large family of virus called corona virus. This virus mainly i...
Q: What is one of the main aspects of design for Enhanced Biological Phosphorus Removal (EBPR)? a) ...
A: EBPR is a sewage treatment method that is used to remove phosphate from sludge (activated).
Q: interaction between cells and their environment
A: Answer :- Cells incorporate signs from their outside and intracellular climate into essential cycles...
Q: What is the phenotype and genotype of offspring in the following conditions? (use the Punnett square...
A: ABO blood group system consists of four types of blood groups - AB, O, A and B. ABO blood group is a...
Q: WHAT IS SNAIL IS CERCARIA OR METECERCARIA
A: Snail is CERCARIA What is CERCARIA? Cercariae are the final intra molluscan larval stages that e...
Q: If there were to be an abrupt change in the climate system, what would be the effect on human civili...
A: Climate change refers to long-term shifts in temperatures and weather patterns or the change in the ...
Q: 45
A: Steps of Enchondral Ossification Cartilage > Bone Detailed sequence elucidated in part 2
Q: Skeletal muscles move as coordinated by the nervous system. sympathetic somatic O peripheral O auton...
A: Skeletal muscles/Voluntary muscles Transverse lines are found at regular intervals. Hence these mus...
Q: In 2008, a DNA technology company, Florigene, Ltd. a Japanese subsidary from Australia claimed the p...
A: Option 4 i.e a transgenic organism was developed.
Q: how they can affect the populations
A: Ecology at the organismic level is essentially physiological ecology which tries to understand how d...
Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...
A: Here, human DATP gene sequence of human is given , i.e : ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC
Q: Which senses are mentioned in the following sentence? "I went outside and felt the cool breeze on my...
A: The sensory nervous system helps us receive the environmental signals and then decode them by sendin...
Q: What are the Rule of Independent Events, the Product Rule, and the Sum Rule. Define single nucleotid...
A: These rules are used in biology to classify events and explain the difference in various events SNP...
Q: What are pioneer species? What is the role of pioneer species?
A: Introductioin In this question we will discuss about the pioneer species and their role.
Q: What happens to the prey species when the predator species population increases? Why? What happens t...
A: Introduction: • An animal that is hunted and killed by another animal known as predator for food is ...
Q: List a diversity of ways some simple animals obtain nutrition without a complete digestive tract
A: Biodiversity is an integral part of the biosphere we live in and various animals shows various modes...
Q: In roses, the synthesis of red pigment is produced by two steps in a pathway. gene O magenta interme...
A: Null mutation :- This mutation is type of loss of function mutation, in this mutation the product ma...
Q: why are gram-negative bacteria unevenly distributed on a slide?
A: why are gram-negative bacteria unevenly distributed on a slide?. Introduction: Bacteria that do no...
Q: Mycobacteria tuberculosis and Rickettsia
A: Mycobacterium tuberculosis is a pathogenic that bacteria from the family Mycobacteriaceae and the ca...
Q: cite literature that predict an approximate shelf-life of a squash soup
A: Squash soup has a creamy texture and is made from a variety of squash species that not only have gre...
Q: How did the scientific community learn that DNA replication takes place in a semi-conservative fashi...
A: DNA replication is the process by which DNA makes exact copies of itself. Several models of DNA rep...
Q: trace a glucose molecule from starch sitting in the small intestine to a body cell. What is the role...
A: A transepithelial transport mechanism, begun at the apical membrane by the cotransporter SGLT-1, tra...
Q: 1. Differentiate Precipitation from Agglutination reactions based on: a. Time duration of the ...
A: Agglutination is the procedure of clumping antigens with their respective antibodies. Agglutination ...
Q: Aside from skin (an organ), what other structures are in the integumentary system of other animals a...
A: The integumentary system is composed of organs and systems that shield the internal body from harsh ...
Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...
A: Flies belong to the order Diptera, which has evolved advanced mechanosensory organs known as haltere...
Q: Repolarization occurs because Multiple Choice more sodium ions diffuse into the cell than potassium ...
A: At the resting stage, the Na+ and K+ channels remain closed.
Q: the treatment that utilizes transgenic organisms to mass-produce proteins O stem cell therapy O gene...
A: Recombinant DNA technology plays a major role in modifying the genetic setup of an organism to have ...
Q: What is the importance of water, carbon and nitrogen for living organisms? Explain briefly.
A: In this question we will discuss about the importance of the water, carbon and nitrogen for living o...
Step by step
Solved in 2 steps
- What is the formula of the net primary production?How does npp relate to the energy pyramids?How do gross primary productivity (GPP) and net primary productivity (NPP) differ?Why do patterns of global primary production on land show strong latitudinalvariation, whereas primary production in the oceans varies largely with distance from shore?
- Figure 46.8 Why do you think the value for gross productivity of the primary producers is the same as the value for totall heat and respiration (20,810 kcal/ m2/yr)?What is the difference between gross primary productivity and net primary productivity.What do you mean by “productivity of an ecosystem? What are the types ofproductivity also mention the factors on which productivity of an ecosystem depends?
- What is Primary Production and what are the factors that limit primary production in terrestrial and aquatic ecosystems. Give examples of where some of the most productive systems are on land and in water. Distinguish between Gross Primary Productivity and Net Primary ProductivityWhat is expected price per hectare at harvesting time of beetroot produced in 1 hectare?What is primary productivity? Give brief description of factors that affectprimary productivity
