What is the output of this program? #include #include #include #include int main() { int s_id; s_id = shm_open("shared_mem",O_CREAT|O_RDWR,0666); printf("%d\n",s_id); if(shm_unlink("shared_mem") == -1) perror("shm_unlink"); return 0; }
Q: Question 4f. Provide the output of the following C++ code? #include using namespace std;…
A: Given: Question4f. Provide the output of the following C++ code? #include <iostream> using…
Q: What is the output of the code? #include #include void modify(int x, int y, int z) std::cout <<…
A: Modifying the given program code: #include <iostream> #include <iomanip> using…
Q: Consider the following Python code: def valid_input(user_in): num = int(user_in) return num %…
A: try-except block : Python programming language has try-except block statements to handle the run…
Q: include using namespace std; template T multIt(T x) {
A: Output is 2.1: 378.228 Code #include <iostream> using namespace std; template <typename…
Q: Provide a complete explaination about this source code below: #include using namespace std; string…
A: Basic elements of a program: Header files : These are files which conation basic function to be…
Q: 1. Write output of the following C code? #include #include int main() { struct tm *ptr; time_t t;…
A: Given, Code: #include<stdio.h> #include<time.h> int main() { struct tm *ptr;…
Q: What is the output of the code? #include <iostream> #include <iomanip> void modify(int…
A: Modifying the given program code: #include <iostream> #include <iomanip> using…
Q: What is the error? 1.int[, ,] arr = new int[3, 2, 2]{{1, 2},{3, 4},{5, 6},{7, 8}}; 2.int[,] hi =…
A: 1. The declaration and the direct initialization of the array's values are not correct because the…
Q: Please I am facing a problem executing the code The question is:. Write a Flex program to check the…
A: The edited code is given below for the above given question
Q: P2a: Whats printed in main? int main() { char a = 'h'; char b - 't'; char c= 'x'; char d = 'w'; char…
A: OUTPUT will be: twix
Q: What is the output of the code?
A: Modifying the given program code: #include <iostream> #include <iomanip> using…
Q: long mult2(long, long); void multstore(long x, long y, long *dest) long t = mult2(x, y); *dest = t;…
A: To do: Convert the given code
Q: Suppose the following code is given(division (/) is integer division) int update(int *p) { *p=*p+2;…
A: - We have to talk about the code regarding devision. - The code :: int update(int *p){ *p=*p+2;…
Q: #include using namespace std; bool isThere(string s, char c, int si, int ei){ //return true if…
A: Input : string s char c int si int ei Output : Write the code to check if the character c is…
Q: What is the output of the following C++ code? #include #include using namespace std; template…
A: Given: What is the output of the following C++ code? #include<iostream>…
Q: Given the code below, assume that all the fork/pipe operations succeed, and neglect any syntax…
A: Answer is given below-
Q: What is the output of the following C code? char *ptr; char mystring[] = "abcdefg", myString; ptr =…
A: We are going to find out the output of given C program.
Q: Vhat are the values of r0, r1, r2, r3, and r4 (in hexadecimal) after executing the following…
A: Answer is given below-
Q: #include void(main) { char name; int num, i; printf("Enter User Name: "\n); scanf("%c",…
A: Hello student Greetings Hope you are doing great. Thank You!!!
Q: Question 4f. Provide the output of the following C++ code? #include using namespace…
A: Given, Programming language used = C++ Code: #include <iostream> using namespace std;…
Q: Write the output of the following code. set serveroutput on size 4000 declare curr course no…
A: Hello Student. Warm greetings from my side. Hope you are doing great. I will try my best to answer…
Q: Read the following function unsigned char PtrGame(void) { int varl; int * var2; unsigned char **…
A:
Q: In the given code below we want to swap a and b. a -What is the problem with code b- Fix the code by…
A: Given code contains two variables a, b. The given program is used to swap the two integers a and b.…
Q: What is the output of the following C++ code? #include using namespace std; class X { int m;…
A: Given the C++ program, the output of that program is given below with explanation.
Q: The program below stores 80 bool values into a char arr[10]. Complete setBool and getBool. In both…
A: Actually, array is a collection of elements.
Q: What is the output of the following C++ code? #include #include using namespace std; template class…
A: Given, Programming language = C++ Code: #include<iostream> #include<stdlib.h>…
Q: #include using namespace std; int main() { char *ptr; char Str[] = "abcdefg"; ptr = Str; ptr…
A: Given, C++ code: #include <iostream> using namespace std; int main() { char *ptr; char…
Q: include int main (void) ( DDRD = 1<<DDD6; PORTC - 1<<PORTCO | 1<<PORTC1; 0x81; TCCROA TCCROB -…
A: Answer is given below-
Q: What will be the output of the following C+ + code? #include using namespace std; class Rect { int…
A: Question. What will be the output of the following C++ code? a) recta area: 30 rectb area: 42 b)…
Q: What the output from executes this program? #include "iostream" using namespace std; int main() {…
A: Please find the answer below :
Q: Assume that filel exists and is empty. Consider what happens when the the program arrow is run. /*…
A: After the program runs what does the command echo $ ?produce? The correct answer is 24 as shown in…
Q: In the given code below we want to swap a and b. a -What is the problem with code b- Fix the code by…
A: Given Code always @ (posedge clk) begin a=b; b = a; end A) There is a problem with…
Q: Show the output of the following code. #include <iostream> using namespace std;int* f(int…
A: The code will shows the error.
Q: In the given code below we want to swap a and b. b- Fix the code by using blocking assignment only.…
A: Verilog code to swap a and b register in content Blocking assignment only non-blocking assignment…
Q: write a C++ program that consumes integer values as command line arguments and returns the…
A: Command line arguments is the method to passed the values to the main() method. It require two…
Q: What is the output of this program? 1. #include 2. using namespace std; 3. int main() 4. { 5. int…
A: PROGRAM CODE: #include <iostream>using namespace std;int main(){int arr[] = {4, 5, 6, 7};int…
Q: a. List all the functions that have been used in the code and mention their type. b. Explain the…
A: According to the code given:- we have to answer on the basic of the code;-
Q: 4f. Provide the output of the following C++ code? #include using namespace std; template T…
A: Given, Programming language = C++ Code: #include <iostream> using namespace std;…
Q: What is Output of the following C++ code? #include using namespace std; template void…
A: The program starts to execute from main() function. To trace the output of a program, start from…
Q: provide output of the following C++ code? #include using namespace std; template inline T…
A: Given, Programming language = C++ Code: #include <iostream> using namespace std;…
Q: What is the problem in this source code? #include using namespace std; int service1(); int…
A: EXPLANATION: - Multiple issues are there in the above code: - cin statement makes use of wrong…
Q: What is the set st4 created by the following Python statements? st1 = set(range(0, 16, 2)) st2 =…
A: st1 is a set having elements {0,2,4,6,8,10,12,14} st2 is a set having elements {0,3,6,9,12,15} st3…
Q: Write the output of the following C++ code? #include #include using namespace std; class A…
A: Que. Write the output of the following C++ code? Ans. Given, Programming language = C++ Code:…
Q: What is the output of the following code? #include <iostream>using namespace std;void f1(int…
A: The code was showing the scope error in the outoput.
Q: #include int main() { const int *p; int a=10; p=&a; printf("%d",*p); return 0; }
A: The output of the following c code #include<stdio.h>int main(){const int *p;int…
Q: Write a code with C to solve this problem: Given 'n' distinct numbers, how many sums of 4…
A: C code :- #include <stdio.h>int c=0;int combinationUtil(int arr[], int n, int r, int…
Q: 2. Write output of the following C code? #include #include int main() { struct tm *ptr; time_t t;…
A: Given, Code: #include<stdio.h> #include<time.h> int main() { struct tm *ptr;…
Q: Consider the following code snipplet, int a[3] = {1, 2, 3}; short *b; b = (short *)a; b++; After…
A: After executing the code, the correct answer to this question is option first 0. Output: -
Q: There is a segmentation fault when sorting. Where did I do wrong? The C code is written below…
A: Lets see the solution.
What is the output of this
- #include<stdio.h>
- #include<fcntl.h>
- #include<sys/stat.h>
- #include<sys/mman.h>
- int main()
- {
- int s_id;
- s_id =
- shm_open("shared_mem",O_CREAT|O_RDWR,0666);
- printf("%d\n",s_id);
- if(shm_unlink("shared_mem") == -1)
- perror("shm_unlink");
- return 0;
- }
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- In this final submission, you will build on checkpoint B to load the database and DNA sequence from files. There will be two databases and several sequences that will be available for download below. Example of the database is the file small.txt: name,AGATC,AATG,TATC Alice,2,8,3 Bob,4,1,5 Charlie,3,2,5 Example of the sequence is the file 1.txt: AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG Implement/modify the following functions: Modify the function readData, which will now take an additional parameter: a string representing the filename containing the database of individuals and their STR counts. It will also return a bool indicating if opening the file was successful or not: bool readData(string filename, vector<string>& nameSTRs, vector<string>& nameIndividuals, vector<vector<int>>& STRcounts) Update the function…Write in C for STM32F446RE microcontroller on the Nucleo-64 dev board uncluding proper header files Write a source library that contains the with the following public functions: void keypadInit(void); /Initiallized the GPIO to read the keypad. uint16_t readKeypad(void); //Returns the state of all of the keypad buttons in the return value at the moment the function is called. void decodeKeypad(uint16_t, char *); //Takes the state of the keypad and returns (by reference) an array of the key's pressed. The library should work with the following main: int main (void) { uint16_t key; char carray[17]; keypadInit(); while(1) { while(!(key = readKeypad())); /*Get which keys pressed*/ decodeKeypad(key, carray); /*What are those keys*/ printf("%s\n",carray); /*Print those keys to screen*/ while(readKeypad() == key); /*Wait for the keypad to change*/ }} Problem 1: Write a library that works with the following…The language we are using here is in Racket. Please enter the following code: (cond ((equal? 16 3) (+ 3 8)) ((equal? 16 8) 12) (else (* 6 3))) Write the return value for the above code. If replacing all of the 16's in the above code with 8, what is the return value? What about replacing the 16’s with 3? What does the cond function do?
- AWS Lambda Function-Python programming Using boto3 library, please give a code that can delete an elastic load balancer with no instance attached to the elastic load balancer Provide code/screenshotNEED CODE IN ASSEMBLY LANGUAGE AND CODE MUST BE MASM615 COMPATIBLE AND PLEASE RUN PROGRAM ON DOSBOX , THANK YOU Write an assembly language procedure named “equalsIgnoreCase”, which receives two strings and their sizes,and returns true if the two strings contain the same characters irrespective of the case. For example, for strings{“aBc”} and {“Abc”} the function returns true, but for {“aBc”} and {“aB”}, or {“aBc”} and {“Xbz”}, thefunction returns false. Write a generic procedure that must handle all checks and conditions.Q1 :- Fill in the missing blank for the given code. 1:- Sample.cpp #include<iostream> using namespace std; class Sample{ public: int number; friend ostream &operator<<(_____(1)_____ &os, const Sample & s ) { os << s.number; return os; } friend istream &operator>>(_____(2)_____ &is, Sample &s ) { is >> s.number; return is; } }; 2:- Main.cpp #include "Sample.cpp" #include<iostream> using namespace std; int main(){ Sample s1; _____(3)_____; _____(4)_____; return 0; } --------------------------------------------------------------------------------- Q2 :- Fill in the missing blank for the given code. 1:- SAMPLE.CPP #include<iostream> using namespace std; class Sample{ public: int number; Sample _____(1)_____(Sample& a) { Sample b; b.number = this->number+a.number; return b; } }; 2:-…
- In C# Suppose variable nums contains a list of integers.List«Integer> nums = Arrays.asList(1, 1, 2, 3, 4, 1, 3, 2, 4, 3, 3, 1);var nums = new List«int> { 1, 1, 2, 3, 4, 1, 3, 2, 4, 3, 3, 1 }Using Java Stream API *or* LINQ, write a short code that prints the following.For each section indicate the platform (whether the solution is given in Java orC# LINQ).A) Print all numbers.B) Print the sum() of the numbers.C) count how many times number '1' appears in the list.do some changes in code and make it unique #include <stdio.h>#include <stdlib.h>#include<string.h>//declaring functionsvoid firstFit(int [], int , int [],int );void bestFit(int [], int , int [],int );void worstFit(int [], int , int [],int );//starting programint main() {//declare partitions and processint partitions [] = {110, 450, 100, 250, 500};int processes [] = {212, 417, 112, 426};//getting their sizesint size_partitions = sizeof(partitions )/sizeof(partitions [0]);int size_processes = sizeof(processes )/sizeof(processes [0]);printf("Partitions size: ") ;for (int i=0; i<size_partitions; i++){printf("%d\t" ,partitions[i] );}//index partprintf("\nPartitions index: " );for (int i=0; i<size_partitions; i++){printf("%d\t" ,(i+1)) ;}printf( "\n" );// calling functionsfirstFit(partitions , size_partitions, processes , size_processes);bestFit(partitions , size_partitions, processes , size_processes);worstFit(partitions , size_partitions, processes ,…Your task is to implement a variation of the classic word game Hangman, which involves players guessing the letters in a word chosen at random with a finite number of guesses. While there are alternate versions such as category Hangman and Wheel of Fortune, which involve players guessing idioms, places, names and so on, we will be sticking with the traditional version. Requirements:You will implement a function called main that allows users to play an interactive hangman game against the computer. The computer should pick a word, and players should then try to guess letters in the word until they win or run out of guesses.Here is the overarching behaviour we expect:1. The program should load a list of available words from the text file provided. Note that the file you have been given contains words in lowercase.2. The computer should then select a word at random from the list at random.3. The user is given a certain number of guesses at the beginning.4. The game is interactive; the…
- By using Linux (Centos 7 or 8) develop a C program to apply the memory times and times, run with this shellprogram, then show the MemToal,MemFree,Active with excel file. Here are the codes for reference. Code no.1: #include <stdio.h> #include <stdlib.h> #include <string.h> #include <unistd.h> main(int argc, char *argv[]) { void * p[100]; int i,times,msize; if(argc!=3) { times=20; msize=1024; } else { sscanf(argv[1],"%d",×); sscanf(argv[2],"%d",&msize); if(msize>10240) msize=10240; msize=1024*msize; if(times>100) times=100; } for( i=0; i<times; i++) {…USE ONLY SHELL SCRIPTING NOT OTHER LANGUAGES. AND MATCH OUTPUT AS IT IS . ------------------------------------- Write a program to compute a^n (a power n) using recursion. Note:Refer to the problem requirements. Shell Scripting Function Specifications:Use the function name as computePower() and the 2 integer arguments.This function returns an integer value that is 'a power n'. Input and Output Format:Input consists of 2 integers.The output is the a power n.Refer sample input and output for formatting specifications. Sample Input and Output:[All text in bold corresponds to input and the rest corresponds to output.]Enter the value of a2Enter the value of n8 The value of 2 power 8 is 256Use the Bash shell for the completion of this project.Develop a shell scripting application that allows the user to perform some advanced mathematicaloperations. Task 2: Find the terms of any linear sequence given by the rule Term = a*n + b, where a and b are integers specified by the user and n is a positive integer and print them in order (for example if the user inputs a=3, b=-4, the first few terms that should be printed are -1, 2, 5, 8, 11…). The user also will specify how many terms the program should print. In addition, the program should print the sum of terms found and a count of how many odd terms were found.
