what is the role of ribosomes in protein synthesis

Q: what is the function and importance of the cytoplasmic DNA?

A: DNA is an organism's genetic substance that carries genetic information and transmits it to…

Q: In protein synthesis, DNA transcription records the genetic message, while ribosomal interprets the…

A: Except for a few viruses, DNA (deoxyribonucleic acid) is the genetic material of all organisms on…

Q: whtat is the function of seperase

A: The protease is also called proteinase or peptidase is an enzyme that allows protein breakdown into…

Q: Know the relationship between exons and protein domains.

A: Introduction: Nucleic acid coding segments found in mRNA are known as exons. Non-coding segments in…

Q: What is a function of chromoplasts and the function of mitochondria

A: Chromoplasts are plastids, heterogenous organelles responsible for pigment synthesis and storage in…

Q: a) Are codons found in DNA or RNA? b) How many bases are in a codon? c) Give an example of a codon.

A: A codon is a DNA or RNA trinucleotide sequence that refers to a certain amino acid.

Q: What is the process of Translation

A: The natural data flows from DNA to RNA, and from that point to proteins. This is the central dogma…

Q: Briefly describe what you know about the structure of DNA and how DNA is packaged in a cell.

A: Nucleic acid was first discovered by Freidrich Mieshcher and was previously called nuclein. Nuclein…

Q: explain the roles of rRNA, mRNA, and tRNA and of ribosomes in protein synthesis

A: The process of protein synthesis is accomplished through translation. Translation is a process of…

Q: Explain the three roles of RNA in protein synthesis.

A: RNA: It is a polymer of ribonucleotides linked together by 3'-5' phosphodiester linkage. In all…

Q: Are there ribosomes in a plant cell?

A: Yes, ribosomes are found in both plant and animal cells, and they function in the same way. Yes, you…

Q: The process of transcription and translation help to crate which type of macromolecules

A: Given: To find which macromolecule is produced during the process of transcription and translation…

Q: What happened when a ribosome reaches a stop codon on the mRNA ?

A: DNA is the carrier of genetic information in almost all living organisms except for a few RNA…

Q: What molecules make up the cell membrane

A: Cell is main elemental unit of the body in which various metabolic activity are performed . It…

Q: Additional ___________Proteins Regulate Transcription and Replication

A: The molecular process such as replication is the formation of DNA from DNA strands so as to pass the…

Q: How many tRNAs must a cell contain

A: In this question, we have to describe number  of tRNA  must a cell contain.

Q: What is the role of DNA in a cell?

A: Nucleic acids constitutes the genetic material of all living organisms. The two most important…

Q: how does a dna molecule code for a protein

A: Deoxyribonucleic acid or DNA is a molecule that comprises of two polynucleotide chains that wound…

Q: are changes to the nucleotides in a segment of dna that codes for a protein.

A: Gene mutations are changes to the nucleotides in a segment of dna that codes for a protein.

Q: Use the codon table shown above to help answer this question. What protein sequence would a cell…

A: The mRNA sequence is: 5' CCAUGCACCAAUAGAUAACCG 3' The Codon is read in triplet form.

Q: where does DNA synthesis take place

A: DNA : It is the chemical name for the molecule that carries genetic instructions in all living…

Q: How does ribosome relate to DNA

A: DNA is the genetic material of almost all living organisms. It contains information that is…

Q: why are cells small

A: The cell is the smallest and basic unit of life. Cells are independent of each other, they take up…

Q: What does DNA code

A: A gene is an essential unit of heredity and an arrangement of nucleotides in DNA (deoxyribonucleic…

Q: Explain the types of RNA & explain how they play role in the process of protein synthesis.

A: Explain the types of RNA & explain how they play role in the process of protein synthesis.…

Q: Explain how some antibiotics work by affecting the process of protein synthesis.

A: Antibiotics are medicines or drugs that are useful for stopping the infections caused by bacteria.…

Q: Within ____________ are instructions for how to make proteins in a cell.

A: Protein  Proteins are the big molecules or macromolecules which are made up of small building blocks…

Q: In one sentence how does ribosome relate to DNA

A: The DNA (deoxyribonucleic acid) is the genetic materials in our body and it contain a specific…

Q: Describe the role of DNA and RNA in protein synthesis

A: DNA (Deoxyribonucleic acid) is the genetic material present in the cells and it is double stranded.…

Q: What is DNA transcription

A: The gene expression is the process in which the genetic information present in the DNA (gene) is…

Q: Which are two types of endoplasmic reticulum?

A: Introduction: The cell is considered as life's fundamental unit. A cell organelle is a subcellular…

Q: Justify the statement "Endoplasmic reticulum is protein assembly line of cell"

A: The RER (rough endoplasmic reticulum) carries a number of ribosomes on its surface that helps in…

Q: makes ribosomes

A: Cell us the basic structural and functional unit of life. It has a clear jelly like matrix which…

Q: Which is the phenomenon of contraction of the cytoplasm from the cell wall.

A: Any solution has 2 components – solute and solvent. Solute is substance which gets dissolved and…

Q: Which function will not be work in the cell in the absence of ribosomes? O Energy release O Protein…

A: Answer to question 1.)  Option b.) Protein Synthesis.

Q: What are the parts of the ribosome and their function?

A: Ribosomes are specific cell organelles and present in both prokaryotic and eukaryotic cells. Each…

Q: Where can ribosomes be found in a cell

A: A cell is the basic structural and functional unit of life. An organism can be made up of two types…

Q: O genetic material and ribosomes

A:

Q: What are different functions of Different parts of a ribosome

A: Ribosomes are present in an animal cell as well as a plant cell. They are found in the eukaryotic…

Q: Is a lysosome part of a cell

A: Lysosomes are included with different cell forms.  In case the cell is harmed past repair, lysosomes…

Q: Speculate why the half-life of mRNA is short, while the half-lives of rRNA and tRNA are long.

A: RNA is a genetic material and basically are of three types rRNA, mRNA and tRNA.

Q: What is cell division and described its importance

A: The cell is the basic unit of life. The tissue is a group of cells that perform a specific function.…

Q: Explain how ribosomes function in polypeptide synthesis.

A: Ribosomes consists of RNA and tRNA together that helps in the synthesis of proteins. Ribosomes are…

Q: three

A: Ribosomes in eukaryotes get their orders for protein synthesis from the nucleus, which transcribes…

Q: Which is true of Prokaryote cells? A) Because their DNA exists in a nucleoid area, the synthesis of…

A: A prokaryote is a cell that lacks a membrane-bound nucleus, mitochondria, or any other…

Q: what is a genetic code and what are its main features

A: DNA aur RNA carries all genetic information .it is expressed in the form of proteins which are made…

Q: The molecule is responsible for bringing the code from DNA to the ribosome during protein synthesis.

A: Ans. The messenger RNA (mRNA), in molecular biology, is a single-stranded RNA molecule that matches…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.