Answered: Use the codon table shown above to help…

Name: Use the codon table shown above to help answer this question.What pro
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Use the codon table shown above to help answer this question.What protein sequence would a cell make from the following MRNA?5'- CCAUGCACCAAUAGAUAACCG-3'РСTNMHQKSPCQNRQPMHQ

Science

Biology

Use the codon table shown above to help answer this question. What protein sequence would a cell make from the following MRNA? 5'- CCAUGCACCAAUAGAUAACCG-3' РСTN MHQKS PCQNRQP MHQ

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 2SQ

See similar textbooks

Similar questions

Choose the combination of answers that most accurately completes the statement. Which of these features is found in eukaryotes but not bacteria? a. polygene mRNAs c. stop codon b. introns
Use your genetic code (codon) table to answer this question: A tRNA has the anticodon GCU. Which amino acid is attached to it? A) alanine B) methionine C) arginine D) threonine E) serine
Refer to the genetic code table and the mRNA sequence below to complete this question: U C U G A U G G G C U U U... beginning with the start codon, which amino acids, in order, are coded for by this section of mRNA? A) Thr-Met- Gly B) Met-Gly-Phe C) Ser-Asp-Gly-Leu .
Use the table to answer: A portion of an mRNA attached to a ribosome reads: 5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′ If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid? What is the last amino acid in this polypeptide? Which amino acid will be the most frequent in the polypeptide?
Which statement BEST DESCRIBES the genetic code? A. There can only be one codon for multiple amino acids. B. There are only 10 different amino acids in proteins. C. More than one codon for a specific amino acid. D. The genetic is misinterpreted to have U instead of T.
Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?
Which statement correctly describes a codon? a sequence of three nucleotides that may code for one protein. a sequence of three nucleotides that may code for one amino acid. a sequence of twenty amino acids that codes for one protein. a sequence of three nucleotides that codes for twenty amino acids. a sequence of three amino acids that codes for one protein.
What is the sequence in the template DNA strand during RNA production that encodes the codon GCU? Answer with 5’ and 3’ ends labeled.
What regulates the process of transcription and translation; compare and contrast these processes.
Which event contradicts the central dogma of molecular biology? a. Poly-A polymerase enzymes process mRNA in the nucleus. b. Endonuclease enzymes splice out and repair damaged DNA. c. Scientists use reverse transcriptase enzymes to make DNA from RNA. d. Codons specifying amino acids are degenerate and universal.
Use the diagram of a gene below to answer the question. The site of transcription initiation is indicated by the arrow. Which letter best corresponds to the location where alternative proteins can be produced from the same gene?
An anticodon of tRNA has the sequence GCA. What amino acid does this tRNA carry? HINT: you use mRNA codons to read the genetic code chart.