Q: which of these is characteristic of gram positive, gram negative bacteria or mycobacteria have a…
A: Bacteria are microscopic prokaryotic ubiquitous organism which do not have nucleus nor membrane…
Q: Substance that moves the electrical field solely depends on the speed of the substance in the…
A: 1. Substance that moves the electrical field solely depends on the speed of the substance in the…
Q: You are studying a cell line that expresses both GPCR-A and G <-B, each receptc binds the same…
A: GPCR A increases cAMP and GPCR B decreases it. Hence any mutation affecting the GPCR B will be…
Q: Now, solve the following problems involving radiation: 1. Why is 1 mGy of alpha radiation considered…
A: Alpha particles is double ionized helium He++ ion. The beta particles is electron like elements.…
Q: The following DNA sequences were used to generate a contig from a genome sequencing project.…
A: Sequencing is a method for determining an organism's whole genetic make-up. The sequence obtained…
Q: Which is most important in catalysis of peptidyl transfer? A Massively parallel sequencing data…
A: Peptidyl transferase is used in the process of translation where protein is synthesized. Proteins…
Q: 40 words or fewer. Explain why we would not survive without primary producers, in particular…
A: Introduction :- Primary producers, also known as autotrophs, are organisms that get their energy and…
Q: Does sexual selection have the potential to accelerate speciation, please provide an example..
A: Sexual selection has a reputation as a major cause of speciation, one of the most potent forces…
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
Q: In order for transcription to begin, the DNA-duplex must be "opened" to allow RNA polymerase access…
A: The self replicating by molecules that is present in the chromosomes and carrying genetic…
Q: How do Restriction Enzymes like EcoRI work?
A: Restriction endonucleases are the enzymes which is used to cut particular region of DNA . They make…
Q: 24. During the disassembly of a nucleosome which part of the nucleosomes is the first to be removed.…
A: The capacity of nucleic acids to guide their own reproduction from monomers makes them unique.…
Q: What is the origin of the blood vascular system both in embryonic and in the extraembryonic areas?
A: Embryonic development, also known as "embryogenesis", is the process through which an embryo…
Q: Describe the behavioural and physiological adaptations that enable many rodents to thrive in arid…
A: Introduction "Adaptation is a physical or behavioural trait of an organism that aids in the…
Q: What are nutritional disorders
A: Introduction :- Any nutrient-related disease or condition that causes illness in humans is referred…
Q: Describe the three domains of a receptor tyrosine kinase. Explain the structure of the…
A: Receptor Tyrosine kinase are the most effective high affinity cell surface receptors that acts for a…
Q: Define epigenetic inheritance
A: Epignetic markers in the cell occurs in the form of DNA methylation, histone tail modifications like…
Q: Which of the following regarding aldosterone is false? the process leading to its release begin with…
A: The option 1 is correct as renin begins the cleavage of angiotensinogen to form angiotensin II. This…
Q: The carpel (pistil), the female reproductive organ of a flower, consisting of _______, ________ and…
A: sexual reproduction is the soil function of the flowers which are the showiest part of plant Flowers…
Q: Explain what happens to urine flow rate, specific gravity and urinary excretion of chloride in each…
A: As it is mentioned in the question the intake is isotonic that means the osmolarity of the intake…
Q: Based on your understanding on the basic structure of fungi especially on the fungal cell membrane.…
A: Fungi Fungi are the uni to multicellular organisms and are non photosynthetic in nature.
Q: In the 33 hr. chick embryo stage what structure/s would serve as a guide to approximately…
A: Auditory vesicles are distinct. Three pairs of arterial arches arise from the ventral aorta. Somites…
Q: Describe how presynaptic targets can be regulated to affect neurotransmitter release at the…
A: Synapse, also known as neuronal junction is the site of transmission of electric nerve impulses…
Q: Describe how presynaptic targets can be regulated to affect neurotransmitter release at the…
A: The neurons are the basic functional unit of the nervous system in our body. Neurons can receive the…
Q: Organisms with favorable characteristics are more likely to survive and pass on their traits to…
A: Variation means genetic differenced between cells, individual organisms or group of organisms.…
Q: Give the economic and ecological importance of Bamboo (the subfamily Bambusoideae).
A: Bamboos are a diverse group of evergreen perennial flowering plants in the subfamily Bambusoideae of…
Q: Match the following hormones with their actions: ACTH epinephrine testosterone ADH estradiol…
A: INTRODUCTION Answers to question 1-10 is given below.
Q: What is corpus luteum. How does it function as an endocrine gland?.
A: Introduction :- During the ovulatory phase, when an ovarian follicle releases an egg, the opened…
Q: Colony of (bacteria): A cluster of cells (or clones) which arise from a single bacterium by asexual…
A:
Q: Outline the structure and function of the brain, spinal cord, peripheral nerves and the autonomic…
A: Function of Brain:- Central coordinating center of the body. Place of association areas and all…
Q: 2-Deoxyglucose or 2-DG is a glucose analog that binds to hexokinase (the first rate- limiting enzyme…
A: 2 deoxyglucose is analogous to glucose but its hydroxyl group reduce in hydrogen thats why it's not…
Q: How do plants and animals regulate their body fluids? Why do you think body regulation is important…
A: The regulation of concentration of body fluids is called as osmoregulation. • The plants absorb…
Q: How does temperature and PH affect the activity of enzymes.
A: Introduction Enzymes function as catalysts. Proteins are the most common, although some RNA…
Q: , differentiate the effect of two varying pH levels (as indicated by by the color) to the amylase…
A: It is an enzyme which is produced by salivary glands and it have seen hydrolysis and digestion of…
Q: Describe the process of DNA replication of the leading strand?
A: DNA replication It is the process by which DNA make exact copy of itself. The replication of DNA is…
Q: 7. Your tire blew out on the way coming to this exam. What would your hypothesis for the cause of…
A: A hypothesis is built to determine the effect of a change on a particular occurrence. Hence, in this…
Q: In most populations, population size remain near the carrying capacity as long as limiting factors…
A: Limiting resources are considered as the carrying capacity for any population.
Q: Choose 1 biotechnology product in the field of medicine. Provide a 1-2 minute monologue about this…
A: The relationship between science and health services is that science creates medicine and methods of…
Q: The inner lining of the vessel (intimate) from the inside extends the epithelium. Name it. O…
A: The inner lining of all the blood vessels like arteries, arterioles , veins , venules and…
Q: what us bZIP and bHLH protein domains? how are they similar? how are they different?
A: Enzymes can bind to DNA to regulate different processes of DNA by certain motifs .
Q: 6. a) What is meant by the term "symbiosis"? [K/U] b) Give an example for each type of symbiosis and…
A: Animals breathe in oxygen and exhale carbon dioxide during the process of respiration. Plants, on…
Q: What is corpus luteum. How does it function as an endocrine gland?.
A: Introduction The endocrine system is a messenger system that regulates distant target organs through…
Q: Bioassay with Spirogyra and bacteria, pigments, photosynthetics T. W. Engelmann (1882) filament of…
A: Photosynthesis is the process that occurs in the presence of sunlight.
Q: A. You are crossing bunnies. The haplotype of a female bunny, Poppy, is as shown in the diagram…
A: In its broadest definition, a haplotype is a collection of DNA changes along a chromosome that tend…
Q: Model 5, continued... 36. As electrons are passed down the ETC, from one member to the next, small…
A: Electron transport system is a system, which involves a series of electron carriers of coenzymes and…
Q: In certain regions, monk seals overturn rocks to catch prey underneath. But nearby sharks often…
A: Introduction Ecological interactions:- It is the relationship between two different or the same…
Q: Which of the following is NOT a true statement? Action potentials are generated only when a neuron…
A: There are few important points that should be kept in mind: Neurons possess electrical excitability…
Q: 1. What is a microtome? Write four types of microtomes and their uses. 2. What are the steps to…
A: We are allowed to do upto three subpart of a question. Please repost the undone question again.…
Q: MULTIPLE CHOICE. A B C D or Duhh 1) Molecules assisted by a transport protein may cross a selective…
A: Introduction :- Active transport is the movement of molecules across a cell membrane against a…
Q: Which types of macromolecules (protein, carbohydrate, fat, or nucleic acid?) can be enzymatically…
A: In mouth digestion of Carbohydrates begins. With the help of salivary amylase enzyme, breakdown of…
A hypothetical population was found to have a genotype frequency of AA=25%, Aa=50%, aa=25%. If the “A” allele determines the larger beak depth of this species (“AA” leads to large beak depth, “Aa” is moderate beak depth, and “aa” leads to smaller beak depth), what type of selection is this trait likely experiencing in this population?
a. directional
b. stabilizing
c. disruptive
Step by step
Solved in 2 steps with 1 images
- Which statement best summarizes why genetic drift tends to impact small populations more than large populations? A. Small populations have a heterozygote advantage because heterozygotes are more common than homozygotes. B. Small populations have a smaller gene pool, so random changes influence them more. C. Small populations have a relatively large gene pool, so the founder effect stabilizes their alleles.D. Small populations tend to experience directional selection, making one phenotype more common.If gene A/a is not in Hardy-Weinberg equilibrium due to natural selection such that individuals with the genotype AA have a fitness value of 1.0, heterozygotes have only slightly reduced fitness at 0.9, and individuals with the genotype aa have a fitness value of 0.6, what kind of change in allele frequency would you expect to see over time assuming you start with equal frequencies of the 2 alleles?Suppose that in a population the frequency of a particular recessive condition is 1/400. Assume this is locus with two alleles (A and a) in the population and that the population is at Hardy–Weinberg equilibrium. What is the frequency of the carriers of this condition in the population? A. 0.9025 B. 0.0025 C. 0.05 D. 0.095 E. 0.0475
- You are studying a population of oysters in Delaware Bay and you find allele frequencies of 0.4 and 0.6 at a locus with alleles A and T, respectively. You know from other research that the migration rate from the continental shelf populations is 0.2, and that the allele frequency of T on the shelf is 0.2. What is the selection coefficient for T in Delaware Bay?10,000 individuals are sampled from a population and are found to display one of three blood types: AA with 6800 individuals, AB with 2800 individuals and type BB with 400 individuals. a) What is the frequency of each genotype in the population? b) What is the frequency of the A allele? c) What is the frequency of the B allele? d) If the next generation contains 25,000 individuals, how many would have blood type BB, assuming the population is in Hardy-Weinberg Equilibrium?In tomatoes, red fruit (R) is dominant over yellow fruit (r). In a tomato plant population exhibiting Hardy–Weinberg equilibrium, if allele r has a frequency of 0.66, what percentage of the population is homozygous dominant for this trait? Express your answer using three significant digits. Answer%
- A group of four birds flies to a new location and initiates a new colony. Three of the birds are homozygous AA, and one bird is heterozygous Aa. A. What is the probability that the a allele will become fixed in the population via genetic drift? B. If fixation of the a allele occurs, how long will it take? C. How will the growth of the population, from generation to generation, affect the answers to parts A and B? Explain.Consider a population of 150 mice on an island, with allele frequencies B = 0.20 for brown coat colour, and b = 0.80 for white coat colour. Brown (B) is dominant to white (b) and the population is in Hardy-Weinberg equilibrium. Twenty-five homozygous brown mice from the mainland float to the island on an uprooted tree after a storm. What are the genotype frequencies before migration? What are the allele frequencies after migration? Now, suppose the twenty-five brown mice float away again on another tree without breeding, and the island is back to its original state. Allele frequencies on the island are back to B = 0.20, b = 0.80. On the continent, there is a large population of many thousands of mice, with allele frequencies B = 0.80, b = 0.20. One year, human ships begin moving back and forth between the island and the continent, and occasionally a mouse comes along for the ride, and stays and breeds. Equal numbers of mice ride in each direction. The shipping trade continues…A hypothetical population was found to have a genotype frequency of AA=20%, Aa=40%, aa=40%. If the “A” allele determines the larger beak depth of this species (“AA” leads to large beak depth, “Aa” is moderate beak depth, and “aa” leads to smaller beak depth), what type of selection is this trait likely experiencing in this population? a. stabilizing b. directional c. disruptive d. none of the above
- A certain autosomal recessive trait occurs in a population with a frequency of 1 in 4900. Assuming that the population is in Hardy-Weinberg equilibrium, what is the expected frequency of heterozygous carriers in this population? A.) 0.014 B.) 0.971 C.) 0.028 D.) There is not enough information to determine this.In a species of lily, the color of the flower’s petals is determined by a dominant purple allele (F) or recessive white allele (f). One hundred flowers in Hardy-Weinberg equilibrium were sampled, and only 15% of the population showed the phenotype of white. Which of the following numbers represents the calculated value of the recessive white allele frequency? A - 0.92 B - 0.39 C - 0.15 D - 0.85Consider a hypothetical beetle whose back abdomen pattern is determined by two alleles A1 and A2. Beetles that are homozygous for the 'A1' allele have solid coloring, beetles that are heterozygous (A1A2) are spotted, and beetles that are homozygous for the A2 allele are striped. You find a population of 100 of these beetles and count each phenotype (shown below). TRUE or FALSE: this population is in Hardy-Weinberg equilibrium? What is the predicted frequency of spotted beetle? Solid Beetles = 49 Spotted Beetles = 35 Striped Beetles = 16 asap please
