What would be the effect on the following processes in a cancer cells treated with Drug X. Match the process with the likely effect of the drug. ◆ Protein Translation ◆ Apoptosis ◆ Cell Proliferation Production of new blood vessels A. Inhibited B. Activated
Q: Use this storyboard to write and illustrate the journey of an egg from ovulation to menstruation.…
A: The egg is formed in the ovary of a female. The eggs are present in the female since birth. Each…
Q: explain why the cell membrane must be partially permeable
A: Introduction In biology, a cell is a fundamental membrane-bound entity that houses the building…
Q: 1. How does the equation for cellular respiration relate to the equation for photosynthesis? 2.…
A: Cellular respiration is a metabolic process by which the cells obtain energy from the breakdown of…
Q: Explain how plants make organic molecules. Include the terms CO2, H2O, photosynthesis, sugar, and…
A: Plant synthesized organic molecule Glucose by using CO2, H2O & sunlight through the process of…
Q: why are folk with diabetes mellitus at a higher risk for amputation of extremities?
A: Introduction Diabetes mellitus is a type of diseased condition in humans. A disease is defined as an…
Q: If the goose with genotype aa had migrated to population 2 as shown but had failed to mate with any…
A: The transfer of genes into or out of a population is referred to as gene flow. This migration could…
Q: Which events or functions in the respiratory system are easily measured by the ergonomist and can be…
A: Ergonomists make sure that the layouts of machines, systems, and buildings offer the greatest…
Q: What forces drive solutes from one side of the membrane to the other? • What solute properties…
A: Introduction: Because they control which chemicals can pass through and how much of each material…
Q: What is the signaling pathway that mediates the organizing activity of the A/P organizer in the…
A: In Drosophila a morphogene i.e. DPP is responsible for the development of wing precursors. DPP gene…
Q: Should similarities in the DNA sequences of genes be considered evolutionary homology? Explain.
A: According to their shared evolutionary parent, distinct species of animals with similar structure,…
Q: 1.It is known that there is an ionic asymmetry between inside and outside of the cells membrane.…
A: MRP- Membrane resting potential It refers to the voltage across a given cell membrane during the…
Q: You isolate the mature mRNAs for each individual and run them on a northern blot. Compared with the…
A: It is a technique which is used to detect the gene expression by analysing the size and abundance or…
Q: How is the increased similarity in the DNA sequences of genes between more closely related…
A: The increased similarity in the DNA sequences of genes between more closely related organisms is…
Q: Do peptide bonds get protonated or deprotonated? Explain
A: Peptides are short chains of amino acids that are linked by peptide bonds. Chains of less than 20…
Q: List the phylum for the species, and assign the following structures to the correct phylum and…
A: We are allowed to do upto three sub part of a question. Please repost the undone questions again.…
Q: a. A triploid cell in females b. tetrasomic cell in males c. tetraploid cell in females
A: The ploidy of a cell refers to the number of sets of homologous chromosomes present in the cell.…
Q: What is the most likely mode of inheritance? b) If this were a pedigree you did NOT want to…
A: * There are four types of pedigree. They are X linked recessive X linked dominant Y linked…
Q: Which of the following is true about nucleosides and nucleotides? Choose all that apply. A…
A: Nucleoside consists of a nitrogenous base covalently attached to a sugar. Nucleotide consists of…
Q: A diploid species has 3 pairs of chromosomes in its somatic cells. In males, the first pair is large…
A: According to the position of centromere present chromosomes can be of different shapes such as…
Q: 1. Why do you need to keep your sample on ice during the sonication steps?
A: According to the answering guidelines I'm going to answer 1st question only. Please post the 2nd…
Q: The presence of a wattle and comb in a rooster is a result of: A. Ongoing presence of hormones in…
A: The wattle is a fleshy protuberance on the neck of many birds, especially turkeys, chickens and…
Q: xplain how the following affect membrane fluidity: – Level of phospholipid tail saturation – Level…
A: A plasma membrane is a selectively permeable membrane. It is made up of phospholipids, proteins and…
Q: 2. List the 4 biologically importance molecules (carbohydrates/lipids/proteins/nucleic acids) and…
A: Introduction : Biomolecules are defined as the organic molecules present in a living cell which…
Q: Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the…
A:
Q: If you are trying to set up a PCR with a total volume of 40uL and you have access to a stock…
A: Inroduction DNA replication occurs in our body. But PCR or polymerase chain reaction is a…
Q: One of your classmates performed a gram stain on Pseudomonas aeruginosa and found variable gram…
A: The "cell wall of Gram-positive" bacteria is mostly composed of peptidoglycan layers that form a…
Q: Changes to the nucleotide sequence in the primary transcript (pre-mRNA) may lead to an error in…
A: * Transcription is the process in which mRNA will be made from DNA . *The end product of…
Q: 1. Phenylethyl alcohol (PEA) agar is a selective media. Which of the following organisms should NOT…
A: The comprehensive research of microorganisms, whether they have one cell, many cells, or are…
Q: Which of the following is a primary function of the active site of an enzyme? a. It binds…
A: Enzymes are proteins that help speed up metabolism, or the chemical reactions in our bodies. They…
Q: NaCl (a salt) can disrupt protein structure. This is true because a protein containing the amino…
A: Glutamic acid is an amino acid that is used in the formation of proteins. It is converted to…
Q: If an individual has a genotype of RR, what would be the possible genotype(s) of the gametes…
A: In a diploid organism, two alleles for a particular gene are expressed & combine to produce…
Q: Estimate the chronic daily intake of 1,1,1-trichloroethane from exposure to a city water supply that…
A:
Q: Explain the three stages of cell signaling. a. receptor b. transduction c. response. Attach images
A: Introduction:- Cell signalling is a very important function of a cell because it allows a cell to…
Q: Based on the a graph, why did the number of wolves increase?
A: Population The similar type of species living together in an ecosystem and can breed is known as…
Q: The girl is focusing a slide and she is turning the coarse adjustment knob up toward the slide. A.…
A: An optical microscope has the following parts:- A stage for placing the slide A set of objective…
Q: 6. Explain how buffer systems are important in organisms. In the human body, bicarbonate and…
A: pH homeostasis is critical because some enzymes cannot operate if the pH varies from what it should…
Q: Which ( somatic or gametes) are made in the process of meiosis?
A: Cell cycle is a series of events that are responsible for producing daughter cells from parent cell.…
Q: A scientist investigating the genome of two related individuals observes a difference of a few…
A: Mutation Change in the sequence of DNA is known as mutation.
Q: Batch fermentation under the conditions described in part b) is carried out in a 100-liter Remember…
A: Penicillins are prescribed to cure diseases such as sore throats, meningitis, syphilis, and others.…
Q: Discuss fully the importance of conducting studies using lab animals
A: For well over a century, the use of animals in scientific study has been a contentious topic. The…
Q: How do cilia and flagella differ?
A: Unlike plants, most of the living animals are motile that is they can travel to different places to…
Q: 70203 52000 CHIRAGRA SPIDER CONCH Harpago chiragra Linnaeus 1758 49+0
A: Introduction Characteristics of Mollusca are- 1. They are triploblastic. 2. They are bilaterally…
Q: 12. When Mendel performed his famous dihybrid cross by starting with a parental lines of peas that…
A: Chi square test helps us to determine whether null hypothesis is rejected or accepted.
Q: If you worked backward, starting with the amino acid sequence of the protein, would you obtain the…
A: The fundamental tenet of molecular biology is the idea that genetic material can only move from DNA…
Q: A male fruit fly, heterozygous for both vestigial wings and ebony body, is crossed with a female…
A: Introduction An expression of a trait, which could be morphological, behavioral, molecular, etc., is…
Q: If the graph represents one actin filament, and line A represents dynamic activity at the plus end…
A: CapZ proteins are not present.
Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU
A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…
Q: 235) mGluRs are metabotropic receptors that are activated by the binding of the neurotransmitter…
A: glutamate receptors:- membrane have usually two types of glutamate receptors i.e. ionotropic and…
Q: The Size of Cells and Their Components: a. (a) If you were to magnify a cell 10,000 fold (typical of…
A: The microscope is the instrument used in biology laboratories to visualize microscopic particles or…
Q: "In a beaker containing 6% NaCl, you place a cell which contains 0.9% NaCl. NaCl doesn t cross the…
A: Introduction : Osmosis is a passive process and happens without any use of energy. It involves the…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- A textbook on cancer contains the following statement: Fundamentally, cancer is a failure of the immune system. Why does this comment make sense?Cancer is related to cellular errors during certain mechanisms and due to certain factors yet, the rate of cancer in cells is low. Describe how cells maintain themselves away from getting cancerous. Give molecular evidences where necessary.''Cancer therapies directed solely at killing the rap-idly dividing cells that make up the bulk of a tumor areunlikely to eliminate the cancer from many patients.'' Is this statement true? Explain why or why not.
- With regard to cancer cells, which of the following statementsare true?A. Cancer cells are clonal, which means they are derived from asingle mutant cell.B. To become cancerous, cells usually accumulate multiplegenetic changes that eventually result in uncontrolledgrowth.C. Most cancers are caused by oncogenic viruses.D. Cancer cells have lost the ability to properly regulate celldivision.Which of these is a characteristic of cancer cells? a. They do not exhibit contact inhibition. b. They lack specialization. c. They have abnormal chromosomes. d. They fail to undergo apoptosis. e. All of these are correct.Which of the following is NOT an example of fail-safe mechanisms that prevent the irregular cell divisions characteristic of cancer? a.Shortening of telomeres b.Cell division limit c.Mutation in a tumor suppressor gene d.Triggered cell death
- Which of the following is typical of cancer cells? A. The parent cell of the tumor contains a single mutation in a single checkpoint gene. B. Malignant cells migrate. C. Cancer cells lose the ability to divide. D. Products of oncogenes inhibit mitosis E. Benign tumors invade normal tissue.Which of the following would improve an individual's ability to avoid cancer while aging?: a. decreases DNA repair accuracy during mitosisb. makes him smaller (e.g., fewer total cells)c. Increase the rate of mitosisd. increases his number of copies of p53e. all of the abovef. none of the aboveThe majority of metastases are the result of cancer cell invasion through which one of the following (select one)? A. Soft tissues B. Skin C. Blood Vessels D. Lymphatic vessels E. Bone
- Which of the following is not a tumor suppressor gene? a.RET b.RB c.BRCA1 d.BRCA2Which of the following types of mutations would be advantageous to a cancer cell (select all that apply)? A. An inactivating mutation in a tumor suppressor gene B. Methylation of the promoter of a tumor suppressor gene C. An inactivating mutation in an oncogene D. Mutation that inactivated DNA repair gene E. An inactivating mutation in an oncogeneA tumor suppressor gene ___regulates the cell cycle; an example is _____. Select one: a. negatively, cyclin b. positively, retinoblastoma c. positively, p21 d. negatively, retinoblastoma e. positively, RAS