What would be the output of the following program? (python) Note: Please note that the operation x % 10 (i.e., x modulo 10) is always the same as the rightmost digit of x (e.g., 123 % 10 = 3).
Q: Find out the errors in the given python program and write correct statements: ' X=int(input(*Enter…
A: X=int(input("Enter x")) #in given statement closing bracket is missing Y=5…
Q: Convert each of the following (non-Python) expressions into Python expressions: x plus 7 is more…
A: Given:
Q: Convert the following algorithm statement to a python statement. Display a decimal value stored in…
A: According to the Bartleby guidelines i answering only first question. The first question is based on…
Q: Provide the Algorithm, Pseudocode, Flowchart, and a Python program (In Python IDLE or PyCharm) that…
A: I have provided PYTHON CODE along with CODE SCREENSHOT and OUTPUT SCREENSHOT--------
Q: Write the result/output of the following python program. x=2 y39 z-yl/x print(y,"/",x."=",z)…
A: Given : Python program: x=2 y=9 z=y//x print(y,"/".x."=",z) print("y=",x\n"x="y) Program is based…
Q: Sort short_names in reverse alphabetic order. Sample output with input: 'Jan Sam Ann Joe…
A: Please find the answer below :
Q: Create a python program with the same output as shown below
A:
Q: What will be the output of given python code given below: print(“foo”*3)
A: Given Code: print("foo"*3) Requirement: Find the Output of the given code.
Q: The Python code to the right would result in a syntax error, because it is missing a sum = sum + i…
A: Refer to step 2 for the answer.
Q: In input you are provided with two words of the same length. Each word contains only lower-case…
A: Note: AS programming language is not mentioned so i am answering it in python language. Given: In…
Q: Consider the value of x=74, y=61, a3D74 & B3D61, and give the output for the below python program…
A: Answer --- 135
Q: Convert the following algorithm statement to a python statement. Accept a decimal value for z.
A: Code: #here z is accepting a decimal valuez = 12.34#printing the z valueprint(z)
Q: Using python, write a program that does the following:
A: This is very simple. The complete code in Python is shown below.…
Q: In your annual examination you are given two numbers X and Y. Below are some tasks that you can…
A: Introduction: According to the given problem statement we have to develop a python code to find the…
Q: What will be the output of the below program: x=10 y=2 X=X+2 y=y+2 print("x+y=",x) error О хну-14 О…
A: Given: what will be the output of the below program : x=10 y=2 x=x+2 y=y+2 print (" x + y…
Q: 34. Write Python Program to Determine all Pythagorean Triplets in the Range?
A: Given Program :- To Write Python Program to Determine all Pythagorean Triplets in the Range?
Q: As you have understood all the theoretical concepts in the class now it's time to do some hands-on…
A: According to the given problem statement we are given a task to develop a python code to find out if…
Q: write a Python Program for below requirements Input: X = 2, Y = 3, N = 10 Output: 7 Numbers…
A: I give the code in python along with code and output screenshot.
Q: What will be the output of the following Python expression if X=345? print(“%06d”%X)
A: Question. What will be the output of the following Python expression if X=345? print(“%06d”%X)
Q: What is the output for the following pseudo code, given the following numbers (2,6,7)? 1. C= 2 2. If…
A: Given Pseudo code 1. C=22. C<4 then Go to step 43. Go to step 84. Input x5. print x*36. Increment…
Q: Problem: Write a Python code that prints a triangle of triangles using the "A" symbol, given height…
A: Step 1: Prompt and accept the number of levels from the user. Step 2: Define the function display()…
Q: Spot the erros in the following java code and correct to match the instructions: Print "userNum1 is…
A: The solution for the problem is given below
Q: Problem: Write a Python code that prints a triangle of triangles using the "A" symbol, given height…
A: According to the information given:- We have to print triangle pattern as mentioned above without…
Q: Type the expression below in python interactively and try to explain what's happening in each case…
A: In python, the character separated by commas(,) are considered as a string. Thus, ('x',) is…
Q: After executing the following program, the Python interpreter will generate an error. Write which…
A: Error is present in Line 3. There is error in number of parameters of insert method. In the code…
Q: Find out the errors in the given python program and write correct statements: X-int(input(“Enter x")…
A: wrong statement are X =int(input("Enter x") Z= X+P C =pow(XY) right statement will be X=…
Q: In your annual examination you are given two numbers X and Y. Below are some tasks that you can…
A: According to the given problem statement we have to develop a python code to find the number of…
Q: Provide the Algorithm, Pseudocode, Flowchart, and a Python program (In Python IDLE or PyCharm) that…
A: I have provided PYTHON CODE along with CODE SCREENSHOT and OUTPUT SCREENSHOTS-----
Q: Translate the statement into plain language, then write a Python program which verifies the veracity…
A: Translate the statement into plain language, then write a Python program that verifies the veracity…
Q: Current date is: 2021-11-05
A: We are going to write python code which will display the current date in the given format.
Q: Consider the value of i=15 & j=15 and give the output for the below python program
A: Step 1:- Explanation:- 1.Initialized the variable i=15 2.Initialized the variable j=15 3.While loop…
Q: In input you are provided with two words of the same length. Each word contains only lower-case…
A: t=int(input()) list=[] a=input() b=input() low,high=0,t-1 rpp="#" while low <= high:…
Q: 2. The Lucas series is series based on adding two previous terms defined as follows if n = 0 if n =…
A: Lucas number The Fibonacci and Lucas numbers are related to each other. The two phrases that come…
Q: Python which from the following is correct print(x) O all the above O print(x, y, z) O print(x+y+z)…
A: print is predefined function in python which is used to display output on screen. It can take…
Q: refer to the python code given below strl="bar" str2="baz" For 11 in strl: for 12 in str2: x=11+12 x…
A: after execution of the program successfully : in the given program z was not defined so the…
Q: What is the output of the following Python code: lis = "12345" num = "0" while num in lis:…
A: Let's first try to understand the code step by step lis = "12345" This statment store the…
Q: b) Using C++/Python ,write a program to find a solution of the equation 1 (x) = x cos x- 2x + 3x –1…
A: Below is the complete solution with explanation in detail for the given question in Python…
Q: n Python take input a value x from user and print the value of 2*x3 - 3*x2 + 12*x -8 in output.
A: Given : Integer x taken input from user. Requirement: Print the value of 2*x3 - 3*x2 + 12*x -8 in…
Q: Consider the following python program and write the output str="UTAS-Nizwa Engineering"…
A: The output will: 4 1 22 UTAS-Oman Engineering
Q: Convert the following algorithm statement to a python statement. Display the value for z.
A: To display value in python , we use print statement.
Q: #include #include int main () { clrscr(); int a; cout>a; if(a<0) { cout<<"The number is negative"; }…
A: Brife description: The user to enter a any number and it is stored in the variable ‘a’. If num is…
Q: = the final output of the following Python print statement: ri in range (1, 6 + 1) : for j in range…
A: Python used to answer this question
Q: 4. Write a PYTHON program to read a Fahrenheit degree and convert it to Celsius degree using the…
A: In the program, where the input will change the temperature from Fahrenheit to Celsius and vice…
Q: What will be the output of the below program: x=10 y=2 X=X+2 y=y+2 print("y") 4 O 2 error
A: What will be the output of the below program: x=10 y=2 x=x+2 y=y+2 print("y") O 4 O 2 O…
Q: Please use the python program Given two numbers X and Y, construct an algorithm to determine the…
A: The Answer is
Q: Write a Python code that fulfils the following requirements. 1- read two positive numbers 2- perform…
A: n1=int(input("Enter 1st number :")) n2=int(input("Enter 2nd number :")) if(n1>n2): l=n2 k=n1…
Q: Write a python programme to display the first 10 prime numbers. You have to apply suitable iterative…
A: EXPLANATION: - The flag variables for the number of primes being encountered so far are defined…
Q: Write a Python Program for below requirements Input: X= 2, Y = 4, N = 20 Output : 5 Numbers…
A: I give the code in Python along with output and code screenshot.
Q: Given a line of text as input, output the number of characters excluding spaces, periods,…
A: 1. input the string 2. set c=0 3. traverse the string 3.1 count all characters excluding spaces,…
Q: 5)Choose the correct result of the given python code. exp=lambda:x=x+y print(exp(2,3)) a. 3 b. 6 c.…
A: Choose the correct result of the given python code. exp=lambda:x=x+y print(exp(2,3)) a. 3 b. 6 c. 5…
What would be the output of the following
Note:
Please note that the operation x % 10 (i.e., x modulo 10) is always the same as the rightmost digit of x (e.g., 123 % 10 = 3).
Step by step
Solved in 4 steps with 2 images
- Q1) true of false -Histogram equalization stretches the histogram so that it is spread from 0 to max.-Coding redundancy happens when the length of the code words is larger than needed.-The human eye is more sensitive to the lower frequencies than to the higher frequencies in the visualspectrum Q2) - Types of data redundancy include _____a) coding redundancy b) psychovisual redundancyc) index redundancy d) a and b - Periodic noise arises typically from electrical or electromechanically interference during imageacquisition featuring _____.a) spatially dependent noise b) spatially independent noisec) white gaussian noise d) None of the aboveExecute the given program in MARS and answer the following short questions..data.textmain:li $a0,5li $a1,4jal func1jal func2func1: add $v1,$a0,$a1 jr $rafunc2:li $v0,10 syscall--------------------------------------------------- a. What is the purpose of jal func1 instruction? b. What is the purpose of jr $ra instruction? c. In which register func1 returns the result? d. Why does not this program terminate after we remove the instruction jal func2. e.caller and callee in this program. Caller: _____________Callee: _____________"C:\PROGRA~1\JetBrains\CLion 2022.2.3\bin\mingw\bin\g++.exe" -g -std=gnu++14 -MD -MT CMakeFiles/untitled.dir/sequence.cpp.obj -MF CMakeFiles\untitled.dir\sequence.cpp.obj.d -o CMakeFiles/untitled.dir/sequence.cpp.obj -c C:/Users/r1821655/CLionProjects/untitled/sequence.cppC:/Users/r1821655/CLionProjects/untitled/sequence.cpp:117:36: error: 'template<class Item> class CS3358_FA2022_A04_sequenceOfNum::sequence' used without template arguments 117 | typename sequence<Item>::size_type sequence::size() const { return used; } | ^~~~~~~~C:/Users/r1821655/CLionProjects/untitled/sequence.cpp:117:53: error: non-member function 'typename CS3358_FA2022_A04_sequenceOfNum::sequence<Item>::size_type CS3358_FA2022_A04_sequenceOfNum::size()' cannot have cv-qualifier 117 | typename sequence<Item>::size_type sequence::size() const { return used; } |…
- 7.Do code complete"""You are given an n x n 2D mat representing an image. Rotate the image by 90 degrees (clockwise). Follow up:Could you do this in-place?""" # clockwise rotate# first reverse up to down, then swap the symmetry# 1 2 3 7 8 9 7 4 1# 4 5 6 => 4 5 6 => 8 5 2# 7 8 9 1 2 3 9 6 3 def rotate(mat): if not mat: return mat mat.reverse() for i in range(len(mat)): for j in range(i): mat[i][j], mat[j][i] = mat[j][i], mat[i][j] return mat if __name__ == "__main__": mat = [[1, 2, 3], [4, 5, 6], [7, 8, 9]].Given one Input String and Pattern Library as follows: Input Strings:TATTTCTGGTCCACCTGATTAATAAGCTTCCTCTACAA TAGAATTTGTCAGGTAGGAATGTGTGTAGACTATAAAGGTCCATGTGTGTAGACTATAAAGGTCCTCACTTCTCTTTATCTACCCT Pattern libraries:TGCGATATGTGAAAGCCTCTAAGG Searching for a pattern in an input string can be done with a certain algorithm and by using the aho-Corasick string-matching algorithm, several patterns at once in the library can be detected in an input string.How to make a finite state machine for the pattern library above?MATLAB Project : Fuzzy Control of Air-conditioner • Use M a x -Min O p e r a tio n & S u g e n o’s Sim plifie d FI E • RoomTemperature ~ x, Outside Temperature ~ y Representative Values forx & y : [20 22.5 25 27.5 30 32.5 35] (oC) • Motor Speed forCompressor ~ z : [0 500 1000 1500 2000] (rpm) • Rule 1: IF (x is LOW [1.0 0.8 0.6 0.4 0.2 0 0]) AND (y is HIGH [00 0.2 0.4 0.6 0.8 1.0]) THEN (z is SLOW [0.6 1.0 0.6 0.2 0] ~ 500rpm) • Rule 2: IF (x is HIGH [0 0 0.2 0.4 0.6 0.8 1.0]) AND (y is LOW[1.0 0.8 0.6 0.4 0.2 0 0]) THEN (z is MEDIUM [0 0.5 1.0 0.5 0] ~1000 rpm) • Rule 3: IF (x is HIGH [0 0 0.2 0.4 0.6 0.8 1.0]) AND (y is HIGH[0 0 0.2 0.4 0.6 0.8 1.0]) THEN (z is FAST [0 0.2 0.6 1.0 0.6] ~1500 rpm) • Rule 4: IF (x is LOW [1.0 0.8 0.6 0.4 0.2 0 0]) AND (y is LOW[1.0 0.8 0.6 0.4 0.2 0 0]) THEN (z s STOP [1.0 0.6 0.2 0 0] ~ 0rpm) • Draw 3D plots for control surface z = f(x,y), andInterpolate x, y, z axes with 31, 31, 21 points, resp. • Outputs àM-Script file “your_program.m” and…
- Computer Science Let C be a black circular disk in front of a white background. The circular disk is parallel to the image plane. This disk is projected on the image plane through a pinhole. What is the shape of the disk’s projection on the image plane? [Hint: A circular disk parallel to the image plane is described algebraically as all 3D points [X,Y,Z]T with (X-X0) 2 +(Y-Y0) 2 =R2 , Z=Z0, where [X0,Y0,Z0] T is the center of the disk and R is its radius.]Find logic errors: #include <Adafruit_NeoPixel.h>#include <string.h> #define NEOS 8#define NPX 10#define AVGS 100 int runsamps[AVGS];double curavg;int count; Adafruit_NeoPixel pixels(NPX, NEOS, NEO_GRB+NEO_KHZ800); void setup() {// put your setup code here, to run once:pixels.begin();memset(runsamps, 0, AVGS*sizeof(int));count = 0;curavg = 50;} void loop() {// put your main code here, to run repeatedly:int newdata;int scaleavg;pixels.clear();newdata = analogRead(8);curavg += (double)runsamps[count]/AVGS;runsamps[count] = newdata;curavg -= (double)newdata/AVGS;scaleavg = round(map(curavg, 0, 1023, 0, 10));for (int n = 0; n < scaleavg; n++){pixels.setPixelColor(n, pixels.Color(82, 35, 152));pixels.show();}delay(10);count++;}+)Do code). """You are given an n x n 2D mat representing an image. Rotate the image by 90 degrees (clockwise). Follow up:Could you do this in-place?""" # clockwise rotate# first reverse up to down, then swap the symmetry# 1 2 3 7 8 9 7 4 1# 4 5 6 => 4 5 6 => 8 5 2# 7 8 9 1 2 3 9 6 3 def rotate(mat): if not mat: return mat mat.reverse() for i in range(len(mat)): for j in range(i): mat[i][j], mat[j][i] = mat[j][i], mat[i][j] return mat if __name__ == "__main__": mat = [[1, 2, 3], [4, 5, 6], [7, 8, 9]].
- import numpy as np import json img_codes = np.load("data/image_codes.npy") captions = json.load(open('data/captions_tokenized.json')) for img_i in range(len(captions)): for caption_i inrange(len(captions[img_i])): sentence = captions[img_i][caption_i] captions[img_i][caption_i] = ["#START#"] + sentence.split(' ') + ["#END#"] network = CaptionNet(n_tokens).to(DEVICE) optimizer = torch.optim.Adam(network.parameters(), lr=1e-3) batch_size = 128 n_epochs = 100 n_batches_per_epoch = 50 n_validation_batches = 5 for epoch in range(n_epochs): train_loss = 0 network.train() for _ in tqdm(range(n_batches_per_epoch)): images, captions = generate_batch(train_img_codes, train_captions, batch_size) images = images.to(DEVICE) captions = captions.to(DEVICE) loss_t = compute_loss(network, images, captions) # clear old gradients; do a backward pass to get new gradients; then train with opt # YOUR CODE HERE train_loss += loss_t.detach().cpu().numpy() train_loss /=…Transcribed Image Text a) What is the number of nodes with 0 child: Answer must be a numeric value. b) What is the number of nodes with 1 child: Answer must be a numeric value. c) What is the number of nodes (in terms of x): Answer format: a+bx, where a,b are any integCOMPUTER GRAPHICSConsider the line segment that joins the point (0, 1) to the point (1001, 0). Which isthe smallest value of x such that a pixel (x, 0) is illuminated by the Bresenham's algorithm?Explain why, according to the properties of the algorithm.