Q: 9. Which of the following statements is false? The SRY gene is absent in all females. b. The SRY gen...
A: 9. Answer: c. The development of maleness is by default because males lack 2X chromosomes. Explanati...
Q: Distinguish between simple diffusion (SD), facilitated diffusion (FD), and active transport (AT) acr...
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for...
Q: There is an addition of Adenine in the MRNA sequence specifically at AUG codon. missense mutation O ...
A: Gene mutations involve alterations in the structure of gene which alters or modifies the structure o...
Q: 1. Write the reason for rejecting the name Lycopersicon lycopersicum (L.) H. Karet. in favor of L. e...
A: The tomato is the edible fruit of the plant genus Solanum lycopersicum and is consumed raw as well a...
Q: You are observing two different cell types and looking for a couple of differences in their mitochon...
A: Cell type 1 will have more extensive energy requirements.
Q: Kael needs to prepare Luria Bertani Agar for 40 plates, 15 slants (big tubes), and 15 stabs (small t...
A: LBA agar is used for cultivation of recombinant E.coli. it is a type of rich medium it is also used...
Q: the complementary strand the 5'and 3' ends and identify corresponding codon as lled V, H, L, T, P, E...
A: DNA is a double-stranded helical genetic material that contains hundreds of genes that code for vari...
Q: Question 10 Match Column A (Description) with Column B (protein/enzyme). v unwinds the double helix ...
A: DNA replication is the synthesize of new DNA on a template DNA strand. It takes place in the nucleus...
Q: Why does gelatin harden and change color when exposed to Glutaraldehyde? Why does this same effect n...
A: Biomolecules are the biological molecules that are present inside the living organisms. These molecu...
Q: DEUTEROSTOMIA Chordata Chordata V [Choose ] Endostyle Anus forms at or near the site of the blastopo...
A: Blastopore :- It is a pit in the side of the embryo, through which cells destined to be endodermal ...
Q: Draw a Punnet square indicating the F2 genotypes from the mating of an F1 male (QQBbHh) with an F1 f...
A: Trihybrid cross is involved because there are found involvement of three genes.
Q: Figure out the mutation. You will need the codon table for this question. WT genomic sequence of a p...
A: The mutation is simple known to state towards the a term that used to describe a change in the se...
Q: 2. Complete the leading strand and the complementary strand vith the 5'and 3' ends and identify he c...
A: DNA replication is the process by which a new DNA molecule is formed and this process is known as DN...
Q: The contraction of cardiac muscle cells results from the increase in Ca?+ levels in the cytosol. For...
A: Digitalis is a drug obtained from the dried leaves of Digitalis purpurea and used in medicine to str...
Q: Comment, based on your knowledge, the possible effect of endocrine disruptors on human sexuality
A: Endocrine disruptors are chemicals that have the potential to cause developmental, reproductive, neu...
Q: Explain 2 ways that microbes may share genetic information
A: microbes have some ways to increase their genetic diversity such as : conjugation transformation t...
Q: True or False? The organism is haploid.
A: A cell or organism with only one set of chromosomes is referred to as haploid. Asexually reproducing...
Q: You find a flatworm during a field trip and discover that the embryos undergo spiral cleavage. What ...
A: The daughter cells are positioned in the grooves of the parent cells in a spiral division. The blast...
Q: What will be the MRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA...
A: The template strand is the DNA strand from which mRNA is made. The non-template, or coding, strand i...
Q: give 3 or 5 examples of GMOs. Introduce these GMOs and cite their purpose and the reasons why they w...
A: GMOs stands for Genetically Modified Organisms. These are created on modifying the genetic material ...
Q: On average, how many ATPs would be made if 6 NADH and 3 FADH2 molecules donated their high-energy el...
A: ATP is the currency of the cell energy it can be utilized or stored for future use by chemical react...
Q: What is the importance of chromosomal crossover events during meiosis I? Explain in a detailed manne...
A: Meiosis is a kind of cell division that produces four haploid daughter cells, each having half the a...
Q: Each of the ff. involves a disorder in the function of an organelle or other cell structure. Identif...
A: Hi, Thanks For Your Question. Answer : Medical Conditions Arise Due To Under Active Or Overactive F...
Q: ou find a flatworm during a field trip and discover that the embryos undergo spiral cleavage. What a...
A: While the cleavage pattern has remained remarkably consistent among taxa, it has undergone numerous ...
Q: How does genetic drift/population size affect the likelihood that a new mutation will become fixed i...
A: "Population variation" is critical to the survival of species. Organisms exist in a continually chan...
Q: 10
A: spiders come under arachnids the body is divided into two tagmata and eight legs they have a fused ...
Q: 6. The proper definition of the ecological niche of the polar bear (Ur. A. the realized niche B. the...
A: A niche is the relationship of an animal group to a certain natural state in ecology. It shows how a...
Q: Think about the pattern of human dispersal. Given what you know about the founder effect, would you...
A: The founder effect is a phenomenon that refers to a small group of people leaving a bigger populatio...
Q: What is crop
A: Answer: Introduction: Recombination helps breeders to make useful new variations of crop plants and ...
Q: Tiedemann's bodies and polian vesicles O purify incoming seawater. extend from the ring canal of the...
A: Answer : Option 1 is correct : Purifying incoming seawater .
Q: Which is not true of both platyhelminths and xenacoelomorphs O possess nephridia O are triploblastic...
A: Invertebrates are creatures that lack a vertebral column (also known as a backbone or spine) due to...
Q: should people continue embracing GMOs?
A: Let us consider the example of the GM crops . The GM crops are fast becoming a part of the agricultu...
Q: What are the functions of enzymes/proteins involved in DNA replication and the process of DNA replic...
A: Replication usuually starts at a specific point on a dna sequence known as the origin of replication...
Q: A mutant is found that has the following protein sequence: Met Gly Thr Leu Arg Gly. What is the like...
A: Mutation is defined as the alteration in gene that result in alteration in the function of the prote...
Q: What is the connection of ATP in Eukaryotic cells to the process of cell reproduction?
A: Every living entity on our planet, whether plant, animal, or other living organisms, reproduces in o...
Q: Glucose diffuses slowly through artificial phospholipid bilayers. The cells lining the small intesti...
A: Small intestine in the digestive system is responsible and play pivotal in the absorption of the nut...
Q: what is a crop:
A: Thank you for your questions. We can only answer a single question at a time to maintain the quality...
Q: What are the enzymes involved in eukaryotic translation? topic is about: DNA Replication and Centr...
A: Eukaryotic translation Ribosomes normally exists as the seperate subunits that are composed of the p...
Q: The period from birth to the natural death of an organism represents?
A: An organism is a living creature with a well-organized structure that can reproduce, develop, respo...
Q: Which one follow a recessive inheitanie pattern? At Hunting ton Disease B phenglke to nuria C-Tay - ...
A: 1 )question Gregor Mendel was an Austrian monk and a mathematician by training performed his famous...
Q: Which direction will the new DNA strand grow, 5' to 3' or 3' to 5'?
A: DNA replication is the process by which DNA molecule makes its own identical copies with the help of...
Q: xamine the following reaction and answer the questions below ased on your understanding of enzymes a...
A: Biosynthesis is defined as the biochemical reactions that result in the formation of a biomolecule. ...
Q: How do pests develop resistance to pesticides?
A: Any animal or plant that is damaging to humans or human interests is referred to be a pest. The word...
Q: A starting population has 150 animals. During the year, 50 animals are born and 30 die. Ten animals ...
A: Population change is the difference in the size of a population between the end and the beginning of...
Q: What does the fossil evidence indicate? A. Mycorrhyzae evolved from the first vasular plants. B. Al...
A: Evolution is the process in which organisms acquire different fundamental characters to ensure their...
Q: Match the muscle with its action. Match each item to a choice: pectoralis major acromiodeltoid inter...
A: Muscle is a type of contractile tissue that is organised into systems for increased efficiency. Musc...
Q: A -B XS Refer to the cross section of the ascidian pharynx above. Structure A is the and is responsi...
A: Ascidian is a member of the invertebrate class Ascidiacea belonging to the subphylum Tunicata. They ...
Q: 2. Within a mouse population, the black fur allele (B) i: dominant to the white fur allele (b) and t...
A: The alleles are mostly dominant and recessive, but there are some other types, such as codominant, a...
Q: Host in the life cycle of a parasite in which the parasite reaches sexual maturity. Group of answer...
A: There are different types of host depending upon the functionality and life cycle of the parasites.
Q: What stages of mitosis are the following pictures? 2.
A: Stages of mitosis in picture : In picture first phase is interphase . In this picture the p...
What does it mean when a cell is described as being dead at functional maturity? How does the secondary cell wall bring this situation about? bartleby
Step by step
Solved in 2 steps
- How is a primary cell wall different from a secondary cell wall in terms of their chemical compositionAn electron photomicrograph of a newly discovered cell shows long projections with a basal body in the cell wall. What kind of projections are these? How might this cell behave in its environment because of the presence of this structure?Why cell wall is non living?
- The formation of a cell membrane is beginning across the middle of a cell and nuclei are re-forming at opposite ends of the cell. What kind of cell is this?Eukaryotic cells and prokaryotic cells differ in terms of having organelles in separate compartments. What is the significance of compartmentalization in eukaryotic cell.What is cell wall
- In plants, the cell wall forms as a young plant cell secretes polysaccharides onto the outer surface of its plasma membrane. Being thin and pliable, this primary wall allows the cell to enlarge and change shape. At maturity, cells in some plant tissues deposit material onto the primary wall’s inner surface. Why doesn’t this secondary wall form on the outer surface of the primary wall?How life would be if the cel membrane won't allow cell transport in and out of the cell?What is the difference between cell membrane and cell wall? What are the three main parts of a cell? Describe and give the main function of each.
