Q: Saliva helps in digestion of 1. Starch 2. Fiber 3. Proteins 4. Fats
A: Saliva are secreted by salaiary glands. These salivary glands are discharge their secretion in oral…
Q: The figure shown is a homunculus of the star-nosed mole. The star- nosed mole has 22 fleshy…
A: Star-nosed moles are not dangerous to humans, but they can cause damage to some landscapes or…
Q: 5. In a given population, only the "A" and "B" alleles are present in the ABO system; there are no…
A: The Hardy-Weinberg equilibrium gives us idea about the allele and genotype frequencies in a…
Q: Free Response: Fruit Flies Genetics To do well on the question, you will need to use the proper…
A: In fruit flies, the phenotype for eye color is determined by a certain locus. E indicates the…
Q: Spotting in horses is dominant over solid color. Black color is dominant over red color. Two…
A: A trait is a characteristic that is unique to particular individual . A dihybrid cross is a cross in…
Q: How does type-1 diabetes affect the endocrine system?-Explain. With hands drawn picture (Within 150…
A: Type 1 diabetes is an autoimmune disease in which the body’s own immune system attacks and destroys…
Q: Morphine (give structure) and enkephelin (give structure) both are antagonists of the m opioid…
A: …
Q: The balancer chromosome includes GFP and a mutation in gene X that causes flies to be sterile in the…
A: A homozygous mutation is one that affects both the paternal and maternal alleles. Compound…
Q: e identical twins not 100% the sa
A:
Q: There may be similarities between different species due to a common ancestor. Davao is known for…
A: The diversity of species on The planet is referred to as biodiversity. Biodiversity refers to the…
Q: explain in detail how a B cell gets activated (clonal selection and proliferation) How are T helper…
A: * Two types of immune response can be seen . They are primary response Secondary response *…
Q: Compare and Contrast Breathing Respiration
A: Breathing and respiration are the major processes that are important for the normal functioning of…
Q: Protein and amino acids are not the preferred source of energy in the body since proteins are used…
A: Proteins are a class of complex nitrogenous organic compound, composed of amino acid residues joined…
Q: 9. The dry type of ear cerumen ("wax") is due to homozygosity for a simple Mendelian recessive.…
A: Both allele and genotype frequencies will remain same in the population generation after generation…
Q: Will insects develop resistance to the toxins produced in Bt corn? a. It is unlikely that…
A: Upon consumption of insecticidal protein developed by Bt corn insects will definitely get killed as…
Q: Which component of cell division machinery is frequently targeted by anti-cancer drugs? Can you…
A: INTRODUCTION Cancerous tumors are characterized by uncontrolled cell division, which is absent in…
Q: Which is true about non-vascular plants?Read
A: Nonvascular plants are called bryophytes. Nonvascular plants include liverworts, hornworts, and…
Q: 3.Which hormone promotes ripening of fruits? Read and analyze the question and choices CAREFULLY;…
A: Ripening in fleshy fruits induces changes such as coloure development, softening, starch hydrolysis,…
Q: What is the sucrose concentration at which zero percent change in weight is observed: What is the…
A: Introduction: Homeostasis is a maintained and stabled movement of materials through the membrane of…
Q: How many copies of a protein need to be present in a cell in order for it to be visible as a band on…
A: * Given that you can load 100 µg of cell extract onto a gel and can detect 10 ng in a single band by…
Q: Construct a Lineweaver-Burk plot to answer the following questions: (a) What are the apparent KM and…
A: The Lineweavwe-Burk plot is the plot between 1/[V] vs 1/[S]. Km = -1/ x-intercept Vmax= 1/y…
Q: Explain the electron transport chain process in cyanobacteria
A: * Electron transport chain consists of series of complexes and other molecules which transfers…
Q: Describe the two types of passive transport. Explain what kind of proteins are required for each…
A: Types of passive transport :-
Q: which category (prokaryotic or eukaryotic) would COVID-19 fall under
A: Prokaryote * Prokaryotes are the organisms which lacks a nucleus and other organelles in a cell…
Q: Name the components of the formed elements in the blood and mention one major function of each of…
A: The elements that make up the blood are as follows: (1) Erythrocytes are red blood cells. They are…
Q: 1. Biolistics: plant tissues; heat shock treatment: _______ a. mammalian cells b. viruses…
A: 1) Answer : Biolistics: plant tissues; heat shock treatment: ____bacteria___ Chemically prepared…
Q: The outermost layer of the hair follicle is the ______________. Group of answer choices E. cortex C.…
A: Outer most layer of hair follicles.
Q: Match the following (you may need to use your book or outside source). -Sacrum Ureter- Seminal…
A:
Q: Fragile X syndrome is an X-linked recessive Achondroplasia is an autosomal dominant trait…
A: Gene expression
Q: The technique used in bacteria for endospore staining can also be used to observe fungal spores.…
A: *Endospores staining is used to recognize presence of spore in bacterial cells This needs staining…
Q: What is the population density of corn in a hectare if the distance of planting is 75 cm x 33 cm…
A: Here are the conversion, (1m is 100 cm) First 75 cm will be 0.75m and 33 cm will be 0.33m
Q: Why would it make sense for a bioprocess to have an upper specification limit, or USL, and to not…
A: Specification:The general definition is the range of expectations for a product to accomplish its…
Q: p. The forward reaction would be written as: Please select the correct letters from graph (a-e) to…
A: Enzymes are biological catalyst. It catalysed all biological reactions that maintains homeostasis.…
Q: After his workout, Devan drinks a protein shake that is high in both protein and sugar and low in…
A: An individual needs food after a workout to refuel, build muscle, and speed up the metabolism.…
Q: Colony shape: round Colony margin: entire
A: bacterial colony is defined as a clump of genetically identical cells that have been derived from…
Q: Define the following terms: a.Simple staining b.Complex medium c.Defined (synthetic) medium
A: Staining is used to visualise the bacteria i clinical specimen under a light microscope. Bacterias…
Q: how bisphenol A effecting human health
A: BPA bisphenol A is a chemical that is use to make plastic. It is a colourless compound which is…
Q: in the process of DNA replication, what happens to its products when DNA polymerase 1 is not…
A: Dna replication is a process through which the amount of DNA is doubled . It is vary vital process…
Q: What happens once the newly made antibodies find and attach to the antigen? What are the 5…
A: * Body shows two types immune response against antigens .They are primary response Secondary…
Q: As a protective mechanism, when this cellular ATP drops, the body takes the fructose and breaks it…
A: Introduction Fructose can be converted to glucose derivatives and stored as liver glycogen, Glycogen…
Q: Which test measures percentage of hemoglobin within each red blood cell?
A: Haemoglobin, Hb is the iron-containing oxygen-transport metalloprotein in red blood cells. It is…
Q: Blood is controlled by three alleles IA, IB, and i. A woman with O type blood has a baby with A type…
A: A blood type is a classification of blood, based on the presence and absence of the antibodies and…
Q: Table 3: My Designer Organism Name of Possible Benefits from Transgenic Organism Since super salmon…
A: Desired Trait - Spider silk Donar organism - Golden orb weaving spiders (Nephila clavipes)…
Q: Complete the table with the correct concepts you have learned about the different characteristics of…
A: Introduction Phyla is a group of related living things that ranks above the class and below the…
Q: why was s1 nuclease used? b) where do you think the mutation is occurring, and whats the…
A: Transcription is the stage when the DNA is converted into RNA. During transcription elongation, the…
Q: QUESTION 10 two cna organisms that don't use starch still grow on a starch plate? organisms are…
A: Starch is a polymer of glucose that is too large to be transported into bacterial cells.
Q: The gray mouse lemur (Microcebus murinus) is a species in which females come into estrus and mate…
A: In case of sexual reproducing organisms the meet selection is very much important in terms of…
Q: .Which refers to all tissues outside the vascular cambium?Read and analyze the question and choices…
A: Plant has two main transport system - xylem and phloem. The xylem helps in transporting of water…
Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…
A:
Q: Discuss how the social environment contributes to the worldwide DALYS (disability-adjusted life…
A: The act of consuming food in order to assist the body to strengthen its immunity is known as…
Where did eukaryotes come from?
Step by step
Solved in 2 steps