Which anatomical skull structure articulates with the vertebral column O mandibular condyle O styloid process sella turcica O occipital condyles O palatine bone

Q: Explain the key to the Sanger technique ?

A: DNA is a molecule discovered in the nucleus by Friedrich Meischer in the late 1860s, but its…

Q: What is gene targeting? Give some examples of gene targeting?

A: Gene is a stretch of DNA in a chromosome  which codes for a functional product either in the form of…

Q: Turnover of RNA and protein helps to control gene expression by influencing the concentration of…

A: Gene expression is a process in which the genetic instructions of genes are utilized to manage…

Q: What is the significance of the fact that couples who cannot taste PTC never have children who can?…

A: 1. couples who cannot taste PTC never have children who can taste PTC because when we cross between…

Q: What biochemical mechanism underlies affinity maturation of the antibody response?

A: Antibodies mediate the adaptive immune response and are produced by plasma cells.

Q: Select all examples of DNA transformation Check All That Apply Transfer of DNA through a pilus into…

A: The process through which an organism receives external DNA is known as transformation. There are…

Q: 1. Insulin..... a. Carries glucose into the muscle cell b. signals the muscle cell to take up…

A: 1. Insulin - b. signals the muscle cell to take up glucose. Explanation - The main actions that…

Q: Which of the following is NOT true regarding the alternative complement pathway? It can be triggered…

A: There are three types of complement pathways: Classical pathway Alternative pathway Lectin pathway

Q: Name the cells which are : (i) double negative T cells (ii) double positive T cells

A: T cells are a part of immune system and develop from stem cells in the bone marrow. They protect the…

Q: Which of the following OPPOSE the movement of fluid from the capillary to the glomerular capsule?…

A: Capillary hydrostatic pressure It is the blood pressure in glomerular capillaries. Generally, It is…

Q: how much nuclear DNA in picograms is present in a skin cell during anaphase?

A: DNA is the genetic material present indide the nucleus of each of the cells in the eukaryotic body.…

Q: What is required to form a phosphodiester bond withanother nucleotide ?

A: Biochemistry is the study of biochemical functions at the molecular and cellular levels using…

Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…

A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…

Q: 9. Two varieties of pumpkin with different weights were crossed: 5 lb. and 29 lb. 3/195 of the F2…

A: aabbccdd=5 lb  AABBCCDD = 29 lb  P: aabbccdd × AABBCCDD   F1: AaBbCcDd

Q: Ammonia concentrations are very low. Using structural formulac, diagram vert one molecule of…

A: Introduction Ammonia production occurs in all tissues of the body during the metabolism of a variety…

Q: Describe ONE likely mechanism of action of a caspase inhibitor. Explain why an inhibitor for…

A: Caspases are expressed inside cells as inactive precursors that must be activated in order to cleave…

Q: For some traits, one allele is not completely dominant to another.  Incomplete dominance occurs when…

A: Incomplete dominant traits are those traits in which one allele is not completely dominant to…

Q: Which molecules, or function groups, or complexes that may be responsible for the absorbance at 595…

A: Spectrophotometry applications are useful to measure the absorbance, reflectance, and transmission…

Q: List and describe three changes in muscles that occur duringendurance training and explain how each…

A: Three changes in muscles that occur during endurance training are:   a slower utilization of…

Q: Test Metabolic process indicated by a positive test. Citrate Indole Catalase Urease Methyl Red/…

A: Citrate test- are used to detect the use of citrate by an organism.  Indole- it differentiates the…

Q: Enumerate and briefly explain four major factors that influence the ability of the female to produce…

A: Egg production can be affected by such factors as feed consumption (quality and quantity),water…

Q: READ THIS: Notice that natural selection does not refer to indiv Trequency of adaptive heritable…

A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…

Q: Insects are ectothermic and the respiratory rate is usually proportional to the temperature of the…

A: Insects are able to cope with the climatic conditions in different parts of the world due to their…

Q: When in a cell cycle are the chromosomes actually replicated

A:

Q: why are apples green red and yellow

A: Introduction :- Apple (Malus domestica), one of the most widely grown tree fruits, is the fruit of…

Q: Explaina about pseudopregnant mouse ?

A: Pseudopregnancy consists of two words "pseudo" which means false and "pregnancy" which means…

Q: 21. Which macromolecules always contain carbon, hydrogen, oxygen, nitrogen, and sulfur? A. nucleic…

A: Introduction:- Any exceedingly big molecule with a diameter ranging from roughly(105 to 103 mm) is…

Q: A new Drosophila phenotype is investigated with a series of crosses. P (parental) organisms are…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Please answer fast What role do sigma factors play in prokaryotic transcription? Which sigma factor…

A: In prokaryotes (as in eukaryotes), transcription necessitates a partial unwinding of the DNA double…

Q: Describe the white and gray matter regions of the cerebrum, cerebellum and spinal cord. Include in…

A: Introduction The Central Nervous System has two kinds of tissues termed grey matter and white…

Q: Identify the benefits and risks of Genetically Modified Organisms

A: Genetical Modified Organisms in Plants Genetical modified plants is nothing but modifying the DNA of…

Q: What is an ecological footprint? Explain what is meantby the term overshoot.

A: An ecosystem is usually defined as the way they are sated as the community of living organisms that…

Q: The increase in air CO2 concentration leads to global warming and extreme weather. What are the…

A: C4 species, the photosynthesis is nearly saturated under recent ambient [CO2] von Caemmerer, It has…

Q: Splicing regulatory (SR) proteins bind at exon to recruit U1snRNP and U2 snRNP during RNA splicing.…

A: There are few important points about splicing apparatus are as follows: The central component of…

Q: Can you please make a conclusion for this? Thank you so much!   Suppose you counted 79 R_ and 33…

A: Mendel's monohybrid cross involves the mating between individuals with different traits for a single…

Q: I1. Electrical impulses in muscle fibers are called 12. Groups of muscle fibers are that are…

A: The movement of skeleton muscles is voluntary in nature and regulated by central nervous system.…

Q: Define 'oestrus’ and ʻmenstrual cycles.

A: These are the characteristics of the oestrus cycle and the menstrual cycle: When the female is in…

Q: 2. In the guinea pig, a locus controlling coat color may be occupied by any of 4 alleles with the…

A: Let suppose the coat colour is controlled by the gene A, As there are many traits for the coat…

Q: What are taxonomic aids? Mention some of the taxonomic aids for identification.

A: Taxonomic aids are devices that are used to study, identify, and classify organisms. Examples of…

Q: discuss , the relationship between cell viability and cell vitality and cell apoptosis as suggested…

A: * Cell viability is ratio of initial cell number to ratio of dead cell number  * A viability assay…

Q: Drosophila melanogaster, the common fruit fly, is a model organism due to the similar relationship…

A: Given that, Researchers have discovered a new trait of fruit fly: blue eyes. A cross has made…

Q: Active immunity is acquired over the course of a lifetime by exposure to antigens. Describe the two…

A: Immunity and immune system Immunity is the ability of the body to fight against consequences caused…

Q: What is a double-stranded DNA molecule ?

A: DNA also known as Deoxyribonucleic Acid is a macromolecule(Nucleic acid). It is found in the nucleus…

Q: Electronic pest control is the name given to several types of electrically powered devices  designed…

A: The table to represent the effect of the ultrasonic device that emitted sound at 40 kHz on both…

Q: Compare the structures and functions of the receptor molecules for salty and sour taste; the…

A: In our body, taste receptors are that kind of receptors who can senses the taste of food in oir…

Q: Compare and contrast diffusion and convection. In what way dothey “alternate” in the O2 transport…

A: Introduction Diffusion is defined as the net movement of something from a higher to a lower…

Q: When SARS-CoV-2 replicates in cells, mutations can occur in the virus’s genome. When mutations have…

A: Mutation  The replacement of one nucleotide base with other nucleotide base is known as mutation.

Q: Describe how the generation of functional beta cells from stem cells requires an extensive knowledge…

A: Beta cells produce insulin, a hormone that regulates the amount of glucose (a form of sugar) in the…

Q: What is RNA sequencing ?

A: Most living organisms that are well-staed to define as they have DNA as their genetic material. It…

Q: Explain how the three forms of adult muscle have various potentials for regeneration after injury.

A: Cell organelles are the building blocks of a cell. They are useful for conducting various cell…