Please do both Question 39Which correctly calls the add(0 function?0.def add(a, b, c):return a +b+O add(2 4 6)O add(2 + 4 + 6)O add(2: 4; 6)O add(2, 4, 6) Question 40How many times will the print statement execute?for i in range(10):for j in range(3):print(F'(i}. 0)0 3O 10O 13O 30

Answered: Image /qna-images/answer/1ee205e0-ffea-45ad-9acd-7e5b244a5afe.jpg

Answered: Which correctly calls the add)…

Which correctly calls the add) function? 0. def add(a, b, c): return a +b+c O add(2 4 6) O add(2 + 4 + 6) O add(2: 4: 6) O add(2, 4, 6)

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

Please make some changes in the code and make it unique #include <stdio.h> int main() { // P0, P1, P2, P3, P4 are the Process names here int n, m, i, j, k,p,c=0; n = 3; m = 3; int ch=1; int adneed[3]={0}; int alloc[3][3] = { { 0, 0, 1 }, // P0 // Allocation Matrix { 3, 2, 0 }, // P1 { 2, 1, 1 } // P2 }; int max[3][3] = { { 8, 4, 3 }, // P0 // MAX Matrix { 6, 2, 0 }, // P1 { 3, 3, 3 } // P2 }; int avail[3] = { 3, 2, 2 }; while(ch!=0) { printf("Enter process number\n"); scanf("%d",&p); printf("Enter requirements of process p%d\n",p); for(i=0;i<3;i++) { scanf("%d",&adneed[i]); max[p][i]=max[p][i]+adneed[i]; //update MAX with additional requirements } printf("Is there any process request ?:(0/1)\n"); scanf("%d",&ch); };…
C PROGRAMMING Consider the following function: void sort(struct Employee * base[], int n, int (*compareFunc)(struct Employee ** , struct Employee **)){ qsort((void **)base, n, sizeof(void *), (int (*)(const void *,const void *))compareFunc);} Use the function above to answer the following questions: 1) What does the line in the provided sort function do? Describe each of the 4 arguments being passed to qsort, and explain why we need that rather strange cast for the fourth argument? 2) Describe generally how we could add a WHERE clause to list - which would allow us to see only specific employees with a certain characteristic. For example, " WHERE SALARY > 10000 " 3) Why does the compareFunc take 2 struct Employee ** parameters, as opposed to just 1 (struct Employee *)?
In this final submission, you will build on checkpoint B to load the database and DNA sequence from files. There will be two databases and several sequences that will be available for download below. Example of the database is the file small.txt: name,AGATC,AATG,TATC Alice,2,8,3 Bob,4,1,5 Charlie,3,2,5 Example of the sequence is the file 1.txt: AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG Implement/modify the following functions: Modify the function readData, which will now take an additional parameter: a string representing the filename containing the database of individuals and their STR counts. It will also return a bool indicating if opening the file was successful or not: bool readData(string filename, vector<string>& nameSTRs, vector<string>& nameIndividuals, vector<vector<int>>& STRcounts) Update the function…
INT_MIN = -32767 def cut_rod(price): """ Returns the best obtainable price for a rod of length n and price[] as prices of different pieces """ n = len(price) val = [0]*(n+1) # Build the table val[] in bottom up manner and return # the last entry from the table for i in range(1, n+1): max_val = INT_MIN for j in range(i): max_val = max(max_val, price[j] + val[i-j-1]) val[i] = max_val return val[n] # Driver program to test above functionsarr = [1, 5, 8, 9, 10, 17, 17, 20].
How would I write these functions in C? Write the function multiThreads to do the followinga. Return type voidb. Empty parameter listc. Declare a constant of data type int to store the number of threadscreated (i.e. SIZE) set equal to 7 (seven)d. Declare a looping variable of data type int (i.e. i)e. Declare a variable of data type int to store the return value fromfunction pthread_create (i.e. error)f. Declare a variable of data type pthread_t as an array (i.e. tid), size7 (i.e. SIZE) g. Loop SIZE times to do the followingi. Set variable error equal to function call pthread_create ()passing as arguments1. The address of the element in thread array tid[i]2. NULL3. The address of function threadFunction4. Explicit type cast (void *) of the address of theelement in thread array tid[i]ii. Evaluate if variable error is not equal to 0 (i.e. indicatingthe thread could not be created)1. Output to the console explicit text2. "\nThread can't be created : [%s]" “Press `Enter' tocontinue .…
1 Can you implement this function please? (Please do not just copy paste an answer, please provide a proper answer for this specific function and I will provide a thumbs up) (Haskell) (Implement at the 'error "UNIMPLEMENTED: renderJSON"' Json to String (Code Provided Below): renderJSON :: JSON -> String renderJSON = error "UNIMPLEMENTED: renderJSON"
Is there any way I can get rid of these warnings below? c: In function 'sortProducts': c:165: warning: assignment makes integer from pointer without a cast c:167: warning: assignment makes integer from pointer without a cast c:178: warning: assignment makes integer from pointer without a cast c: In function 'palindrome': c:211: warning: assignment makes integer from pointer without a cast c:211: warning: 'i' is used uninitialized in this function c: In function 'sortProducts': c:165: warning: 'i' is used uninitialized in this function Here is the program below. 157 int * sortProducts (int* A) 158 { 159 //LOCAL DECLARATIONS 160 int t; //temporary variable t 161 int *j; //dkdsk 162 int *i; //smkl mkl 163 164 //EXECUTABLE STATEMENTS 165 for (*i = A; *i != -1; i++) 166 { 167 for(*j = (i + 1); *j != -1 ; j++) 168 { 169 if(* (i) > * (j)) 170 { 171 t = * (i); 172 *i = * (j); 173 * (j) = t; 174 } 175 } 176 } 177…
Python Question What is the time complexity of the following function? def mystery(lst): index = 0 while index < len(lst): index2 = 0 while index2 < index: index2 = index2 + 1 index = index + 1 a) Linearb) Quadraticc) Slower than quadraticd) Faster than linear
Write a function called sumSeries that computes the following summation:?(?) =1/2 +2/3+....+i/(i+1)Write a test program that uses sumSeries to display the following table:i m(i)1 0.50002 1.1667…19 16.402320 17.3546
Below 09. Question Given a sequence like [1, 2, 3, 4, 5], and an array of sub sequences like [[1,2], [3, 4], [5]], return true or false if the given sequence could be constructed from given sub sequences. The selected sub sequences would concatenate to construct exactly the given sequence. Please write python function to answer the question.?
13. Write function updateBoard to do the following a. Return type void b. Parameter list i. 1-d character array (i.e. move), size 3 ii. 2-d character array (i.e. board), size 8 rows and 8 cols iii. Structure Player (i.e. player) as a pointer c. Declare local variable rowInt, data type integer, set equal to function call getMoveRow, passing parameter move as an argument d. Declare local variable colInt, data type integer, set equal to function call getMoveCol, passing parameter move as an argument e. If calling function checkHorizontal (i.e. see argument list in step f.i.) is greater than ZERO, call function updateHorizontal, passing as arguments i. rowInt ii. colInt iii. board iv. player f. If calling function checkVertical (i.e. see argument list in step f.ii.) is greater than ZERO, call function updateVertical, passing as arguments i. rowInt ii. colInt iii. board iv. player g. If calling function checkDiagonal (i.e. see argument list in step f.iii.) is greater than ZERO, call…
In the Mergesort, the idea is to merge two arrays or list of two numbers, where each of those arrays are sorted. The merged array becomes fully sorted. The following code snippet makes the process of merge happen. Assume an array A={4, 11, 2, 9, 6}, where we want to split that array and then merge it. If we call the function "merge(A, 0, 2, 4)", how would the array A look like after the merge operation?* 4, 11, 2, 9, 6 2, 4, 6, 9, 11 4, 11, 9, 2, 6 4, 11, 6, 9, 2 11, 9, 6, 4, 2 4, 9, 6, 11, 2