Answered: Which gene regulation event is ONLY…

Name: Which gene regulation event is ONLY present in prokaryotes? a. transcr
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which gene regulation event is ONLY present in prokaryotes? a. transcription level of regulation b. Capping of precursor mRNA c. Polyadenylation of the 3' end of the mRNAs d. mRNA splicing

Science

Biology

Which gene regulation event is ONLY present in prokaryotes? a. transcription level of regulation b. Capping of precursor mRNA c. Polyadenylation of the 3' end of the mRNAs d. mRNA splicing

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1SQ

See similar textbooks

Similar questions

Write a brief essay that discusses why you think gene-regulatory systems evolved in bacteria, and why genes related to common functions are found together in operons.
a) Define the term gene expression b) State 4 difference between prokaryotes and eukaryotes gene expression c) state the importance of regulating gene expression
Which statement BEST DESCRIBES the genetic code? A. There can only be one codon for multiple amino acids. B. There are only 10 different amino acids in proteins. C. More than one codon for a specific amino acid. D. The genetic is misinterpreted to have U instead of T.
ANSWER WITH EXPLANATION How does negative gene regulation allow bacterial cells to conserve energy and maintain efficiency ? Use the lac operon as an example .
Why was the cold ethanol added to the soap and salt mixture? A To digest the cell walls B To dissolve the RNA C To emulsify lipids and remove large cellular debris D To precipitate the DNA E To denature the cytoplasmic proteins
Which is true of the lagging strand in DNA synthesis? a. It is built elongating towards the replication fork b. It is composed entirely of RNA c. It is built in the 3’ to 5’ direction d. It elongates in a series of segments, rather than continuously
Which rRNA plays a major role in the aligning of the transcript in the ribosome of prokaryotes? A. 28S rRNA B. 23S rRNA C. 16S rRNA D. 18S rRNA
using a table, compare how histones and micro RNA control gene expression
Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?
Which is associated with the silencing of the genome? - transcription factors - histone acetylation -DNA methylation
Infer how COVID19 RNA might be replicated in human cells. Use the following RNA sequence (the sense strand) in your response: 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’
What is the role of transcription in the determination of the amino acid sequence of a polypeptide chain? A. It pairs anticodons and codons. B. It synthesizes an mRNA strand. C. It duplicates the information in DNA. D. It decodes the information from mRNA.