The question is : Our intestinal tract is filled with probiotic bacteria which are the bacteria that help with food digestion and inhibit the growth of the pathogenic bacteria. Predict the possible effects of the overuse of the antibiotic on probiotic bacteria living in our digestive system and the possible consequences to an individual

Q: Cohort: Trematoda Order: Diplostomida Genus: Schistosoma Common Name: Blood Fluke

A: Introduction Blood fluke (Schistosoma) are the parasitic flat worm causes infection in human called…

Q: The tricuspid valve is located between the

A: Human heart is a muscular organ about the size of a fist. It is located just behind and slightly…

Q: Q4.10. A cell has been exposed to a poison that stops ligase from working. If all other enzymes are…

A: The mechanism wherein the genome's Dna is replicated in cells is known as DNA replication. Prior to…

Q: What is the most important reason for evolution of bacteria? Explain briefly. GiG of cancer by…

A: Bacterial evolution has continued over the billions of the years since the precambian time period.…

Q: List Darwin's Postulates and show which ones are random and which ones are deterministic

A: Evolution Evolution is a continuous process involving change which occurs due to the adaption of new…

Q: Kevin and Sonia want to prepare a bean salad for the class picnic. They buy a package of dried…

A: Introduction: To soak beans the old-fashioned manner, cover them with 2 inches of water, 2 teaspoons…

Q: Mary is 65 years old and has just been told that she has osteoporosis. What is osteoporosis and how…

A:

Q: STR ⒸDigital Frog International A B

A: Introduction  The heart, blood vessels, and blood are all part of the blood circulatory system,…

Q: Please observe the tetrad of duplicated homologous chromosomes. Have a single crossover take place…

A: Alleles are the alternative form of a gene that are located on the same locus of Homologous…

Q: How does genetic analyses of fossils help us understand human evolution better than just examining…

A: following is description of how genetic analysis of fossils help understanding human evolution…

Q: What kind of information What is the application is derived from polyphasic taxonomy? of polyamines…

A: Bacterial taxonomy is made up of the interconnected fields of classification, nomenclature, and…

Q: Do you believe that chimpanzees should be classified in the same family and/or subfamily as humans?…

A: Chimpanzees and humans are almost identical. The difference between two humans would more or less be…

Q: Answer the following about low carbohydrate diets: true false Is made up of a large about of nonfat…

A: Introduction Carbohydrates form important biomolecules in the diet of every organism. These…

Q: the liquid viscosity is density intendent. True O False during the diastolic of the cardiac cycle…

A: Introduction  When the membrane potential of a specific cell region rapidly rises and falls, it is…

Q: Name five functional traits of microorganisms. What dose the functional diversity describe? Do we…

A: Functional traits of the microbes describe individually expressed phenotypes or characteristics of…

Q: Why does the hydrolysis of ATP release so much energy?     Because very strong bonds are required…

A: The mechanism of ATP hydrolysis is an exergonic one. It generates adenosine diphosphate (ADP),…

Q: Q3.9. For which of the following is potential energy DECREASING? (Hint: Click here to see an…

A: INTRODUCTION Potential energy is stored in living cells in the form of ATP.

Q: Which of the following is true of overexploitation? Select ALL that apply.   a Only animals are…

A: Overexploitation is the exploitation of a resource to the point of depletion. It occurs when the…

Q: Fats, cholesterol and waxes are examples of which type of biomolecules? * A. Carbohydrates B.…

A: Biomolecules are chemical compounds found in living organisms. These include carbohydrates, lipids,…

Q: During the process of anaerobic cellular respiration, the final electron accepter in the electron…

A: Anaerobic respiration is the respiration process similar to aerobic respiration but it does not use…

Q: Explain why bacteria are limited to growth within a given temperature range? Explain why bacteria…

A: Bacteria are single-celled organisms with a small size. Bacteria can be found practically everywhere…

Q: Description Unicell or multicell? Cell wall? Nuclear envelope? Membrane bound organelles? Bacteria…

A: Introduction :- Bacteria are minute, single-celled organisms that can be found in large numbers in…

Q: Clearly distinguish between the 3 parts of glycolysis.

A: The breakdown of glucose to provide energy is known as glycolysis. Pyruvate, ATP, NADH, and water…

Q: You cross pure breeding plants with short stamens and white flowers to plants (also purebreeding)…

A: Map distance reflects the physical distance between two genes or two alleles. The genetic map is…

Q: Name: - In humans, being a tounge roller (R) is dominant over non voller (r). A man who is a…

A: As per BNED rule only first question should be answered, so kindly submit the other question…

Q: RISA

A: The full form of RISA is Ribosomal RNA Intergenic Spacer Analysis. This type of analysis is referred…

Q: Omics techniques 100?

A: Omics techniques  is a technique which can measure the total composition of a specific biochemical…

Q: Which of the following not a characteristic of immur secondary response? ○ IgG isotype ○ No lag…

A: This is the subsequent immune response after the primary immune response, also known as the…

Q: Which of the following regarding statements Darwin and his theory of evolution is false? Darwin…

A: Darwin contributed to the science of evolution. Darwin established that current species of organisms…

Q: Cucumis sativus (cucumber) is a diploid plant with 7 chromosome pairs. Determine the following as…

A:

Q: 15. In which of the following forms is energy immediately made available for the use of living…

A: Each body cells need energy in order to perform various body or metabolic functions. The energy can…

Q: In table 21.1, the effects of injection of different types of RNA into wild type mice was examined.…

A: miRNA(micro RNA) is type of non coding, single strand RNA. It involves in gene silencing and…

Q: The following chemicals are involved in electron transport. Which of these chemicals has the…

A: Introduction: The electron transport chain, also known as the respiratory chain, is found in the…

Q: The Riccia is a bryophyte because: ○ It has multicellular sex organs with a sterile jacket and lacks…

A: Bryophyte These are the group of non-vascular plants that have no roots or vascular tissues. These…

Q: Most of you have seen oak leaves fall on driveways and on streets when fall arrives. These pigments…

A: Tannin is a water-soluble poison that is found in oak leaves. If you were to rub your skin with oak…

Q: Briefly explain, using a concrete example, how allopatric speciation can lead to the appearance of a…

A: Speciation is the process by which new species emerge. Speciation occurs when an ancestor species…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: What is the proper term for the group of reproductive cells that pass genes on to the next…

A: Reproductive cells are formed through meiosis. Meiosis is reductional division.

Q: 4. In humans the primary purpose of cellular respiration is A the removal of CO₂ from animal cells…

A: Introduction :- The metabolic pathway that breaks down glucose and produces ATP is known as cellular…

Q: A rise in the intracellular Ca2+ concentration causes muscle cells to contract. in addition to an…

A: Introduction :- Calcium pumps are a type of ion transporter found in all animal cells' cell…

Q: Match the water soluble vitamin with its deficiency megaloblastic anemia, cognitive decline, age…

A: Vitamins are the key component of cellular pathways for example- hydroxylation of collagen protein…

Q: 3. Draw a photosystem and label the parts.

A:

Q: 2. A learner carried out an experiment on water loss from leaves. The learner wanted to find out…

A: Introduction  Leaf base, leaf lamina, and petiole are the three primary elements of a leaf. Simple…

Q: What are the basic components of a Fluorescence Microscope and what are the functions of each? Are…

A: Microscopes are laboratory instruments that are used to view and study things that cannot be seen…

Q: Sequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which…

A: In our Desire primer it  is 15 nucleotide long however on gels there are only 10 bands are present…

Q: Phenylketonuria (PKU) is a disorder caused by a recessive allele. Two carrier individuals have…

A: Given: Phenylketonuria (PKU) is a disorder caused by a recessive allele. Two carrier individuals…

Q: Identify the mismatched pair. (Select all that apply.) a. type I hypersensitivity: mast cells,…

A: Different types of hyper sensitivity are the undesirable reactions produced by the normal immune…

Q: The non-wild-type alleles are k (clipped wings), l (long tail), and m (magical powers). The parental…

A: Here the test cross that produced 1572 offspring was conducted between k/k+  l/l+  m/m+…

Q: Which of the following describes cardiac muscle tissue? Select all that apply.   a striated b…

A: Introduction Cardiac muscles, these types of muscle are found only in the walls of the heart. It is…

Q: How is our concept of human form and function today affected by inventors from the seventeenth to…

A: Introduction :- Humans are the most numerous and ubiquitous primate species, distinguished by…

Stress

Stress is defined as the feeling of being overwhelmed or unable to cope with emotional or mental pressure. Any event or action that makes a person annoyed, furious, or nervous can trigger it. Chemical changes in the body caused by stress can cause blood pressure, blood sugar levels, and heart rate to rise.