Which of the following is the most important factor in the development of acne? A. Bacteria B. Chocolate and greasy foods C. Cosmetics D. Hygiene F Stress

Q: 10. Compare and contrast fermentation to cellular respiration. Click and drag the following to the…

A: Cellular respiration is an important part of the biochemical process taking place in the living…

Q: exaplin in detail histamine H1 and its links to meyparamine antagonist.  Provide mechanims and…

A: The Immune System defends our bodies against infections. Pathogens include parasites as well as…

Q: What is the significance of having a properly collected urine What is the drawback of routine…

A: Question :  What is the significance of having a properly collected urine. Answer : Proper…

Q: Suppose a new mutation arises in a mitochondrial genome. Explain what would have to happen in order…

A: Mitochondria is a double membrain bound cell organelle found in eukaryotic cells. It contain double…

Q: Which processes of evolution apply to the development of the Neandertals? Genetic drift Natrural…

A: Neanderthals These are extinct species who lived in Eurasia about 40,000 years ago. These are…

Q: Write down the functions of the following body system. Body System Functions 1. Skeletal System…

A: Introduction  The human body has 11 distinct systems, collectively referred to as organ systems,…

Q: Pre-work 2- Key Takeaways: The electron transport chain allows for the efficient transfer of energy…

A: Adenosine triphosphate (ATP) is considered to be the energy currency of all cells produced by…

Q: Put the steps of a virus infecting a target cell in the right order: viral nucleic acid is…

A: The virus infects a target cell and then replicates releasing new viruses. The viral replication…

Q: Which among the following statements is CORRECT? The thylakoid membrane, in the chlorophyll,…

A: Introduction Stroma is important as it consists of enzymes required for the fixation of carbon…

Q: what is the mRNA Sequence? ATC GG ATACAAT

A: DNA and RNA are nucleic acids that are found in living cells. Almost all living cells contain both…

Q: In tabular form, differentiate the differences in morphology of monocot and dicot fruits

A: The most varied class of plants are the angiosperms or blooming plants. This group includes the…

Q: Name the chromene rich plants located in India (minimum 10) and their common name.

A: Chromene or Coumarin is utilized in the pharmaceutical business to take anticoagulants. Coumarins…

Q: Based on the group it belongs to, which land plant innovations are possessed by Dicranum scoparium…

A: Introduction Vascular plants, otherwise called Tracheophyta, structures an enormous group of plants…

Q: Brianne does not have children. Daniel has four children. 1. Describe Brianne's fitness. 2. Who has…

A: According to the law of natural selection given by the darwin the nature selects the fittest. Here…

Q: How are vesicles with neurotransmitter transported to the synaptic cleft? A. Retrograde, slow…

A: Nervous system is a body system which is involved in transmission of impulse, control as well as…

Q: QUESTION 6 The agouti gene in mice plays a role in determining coat colour. At this locus (a term…

A: The dominant recessive nature of two or more alleles of a gene decides the phenotypes. The genotypes…

Q: Miles and Misra serial dilution strategy to determine bacterial density (cfu/ml) and if infection is…

A: Miles and Misra's method is also known as viable surface count. This method counts a number of…

Q: The mismatch repair (MMR) components work closely with the DNA replication machinery

A: The mismatch repair or MMR is a process by which DNA is repaired by removing the mismatched…

Q: The only protein bound to the labeled hormone is identified in the new clear fraction. Hormone X is…

A: Hormones are the chemical compounds which are secreted from the respective endocrine glands. These…

Q: Assume the DpnI digestion has failed after the PCR in the synthesis of mutated plasmid by thermal…

A: DNA that has been methylated or hemimethylated is unique to Dpn I. The majority of E. coli strains'…

Q: Explain the target microbes/microorganism and mode of action of the antibiotic ofloxacin

A: A quinolone antibiotic called ofloxacin is effective in treating a variety of bacterial illnesses.…

Q: Diabetes type .....is characterized by.....effectively be managed by diet and exercise. 1 (one); an…

A: Diabetes is a chronic illness brought on by either insufficient insulin production by pancrease or…

Q: Explain why digestion with EcoRI and Hindlll might give more than one insert fragment with some of…

A: Introduction Restriction endonuclease or restriction enzyme cut the double stranded DNA at a…

Q: Genes from Denisovans have been detected in modern humans especially from Europe Indonesia China…

A: Introduction Evolution is the process by which an organism inherits or adapts favourable…

Q: The results of blood agar from the umbilical cord(a) and blood culture(b) both show beta haemolysis…

A: Microorganisms require nutrients for life, development, and reproduction, which are provided by…

Q: A human STR locus contains a tandem repeat (TAGA), where n may be any number between 5 and 15. How…

A: Introduction The traits of a living organism are determined by its genotype. These traits are…

Q: Once a healthy biological male has reached adulthood, do his cells continue to divide by both…

A: In multicellular organisms, like humans ,Cells divide by various methods in biology. In normal…

Q: (a). Four of these energy-rich molecules are produced in glycolysis: (b). Glucose is split into two…

A: Introduction  In order to get chemical energy for cellular processes, organisms require oxygen to…

Q: Mature human insulin is synthesized from a single Gene but contains two polypeptide chains (A and B)…

A: Introduction Pancreas is a holocrine gland present in our body. It has both endocrine and exocrine…

Q: A male has a particular X-linked recessive genetic disorder. His partner is normal, but her father…

A: Introduction  Our biological parents pass on certain genetic traits to us. The term "X-linked…

Q: || AB ||| AA 1 0₂ AA AB 2 BB 0₁ In this pedigree A and B represent alleles at a marker locus very…

A: Introduction : The study of a specific trait that is passed down from one generation to the next is…

Q: What is the new DNA sequence and the corresponding new amino acid sequence of these two mutations?…

A: Mutation is any change in the DNA sequence. These are of different types for example, missense…

Q: An insulin-dependent diabetic patient calls the office complaining of sudden onset of nausea. Upon…

A: Diabetes type 1 is a chronic illness also referred to as juvenile diabetes or insulin-dependent…

Q: Write a detailed account  of how the body monitors blood pressure with baroreceptors and how the…

A: Introduction: Baroreceptors is a type of mechanoreceptor that allowing for the relay of…

Q: What reagent is used in this test? B A O Kovac's O Negrosin O Safranin lodine

A: Introduction The performed is SIM (Sulfide, Indole, and Motility) test, is done to differentiate the…

Q: During acclimatization to altitude, lowlanders develop which of the following? Metabolic acidosis…

A: Depending upon the pH level the body fluid could be acidic or alkaline.  When pH is low, the…

Q: Which among the following is not a raw material of light dependent reactions of photosynthesis?…

A: Please follow step 2 for detailed explanation.

Q: Johnny has just been infected and needs your help in letting him know how his body is fighting the…

A: The main function of immune system is to distinguish between self and non sell. its primary function…

Q: Does DNA alterations during DNA replication result in the formation of cancerous cells? And how does…

A: DNA is the deoxyribonucleic acid, which contains the genes in the form of a sequence of nucleotides,…

Q: Which is the best possible hypothesis for explaining changes in cortical robusticity over time? a.…

A: The correct option is: The Increasing cortical robusticity associated with appearanceof morden…

Q: Which method of drug administration offers the highest control over dosage and delivery, but also…

A: Answer : method of drug administration offers the highest control over dosage and delivery, but also…

Q: What conclusions are there about how glucose is oxidized based on what is learned about the cellular…

A: A glucose molecule gradually decomposes into carbon dioxide and water during cellular respiration.…

Q: glucose Glycoly sis (b). Glucose is split into two 3-carbon chains called AcetylCoEnzymeA in order…

A: Cellular respiration can be defined as a set of metabolic processes that occurs in the cells of…

Q: C. In a horse population, three different traits showing continuous distribution were measured, and…

A: A measure called heritability is used in breeding and genetics to determine how much phenotypic…

Q: The following DNA sequence is found on a chromosome in rice plants:               5’…

A: Given DNA sequence:  5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ Since, this is the…

Q: Which of the following describes training to strengthen the neck for tactical athletes?  A necessity…

A: Athletes are people who take part in physical activity in order to compete in sporting events. There…

Q: All mutations in mitochondrial genes ultimately affect (whether directly or indirectly) the key…

A: Introduction: It goes without saying that the primary purpose of mitochondria is to produce ATP.…

Q: Based on the schematic below, illustrating the control of the hypothalamus and the pituitary gland…

A: Menstural cycle is a monthly physiological process occurs in every female after puberty.  It have…

Q: How was the normal range of phenotypic variation within and between groups so different than it is…

A: The physical manifestation, or traits, of that attribute, is referred to as phenotype. It describes…

Q: Which of the following statements related to the Calvin Cycle is CORRECT? Six molecules of G3P are…

A: Calvin cycle is the part of photosynthetic reactions, where carbon is fixed into sugar. This…

Risk Factors

The factors in the body that trigger the probability of suffering from a disease are referred to as risk factors. For example, an excessive increase in an individual's body weight can trigger the chances of getting heart disease. Similarly, if an individual is exposed to carcinogenic substances, it increases the probability of suffering from cancer. These factors can pose a severe threat to the overall health of an individual.