Answered: Once a healthy biological male has…

Once a healthy biological male has reached adulthood, do his cells continue to divide by both mitosis and meiosis? Outline when each type of cell division might occur.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter2: Cells And Cell Division

Section: Chapter Questions

Problem 22QP: Match the phase of cell division with the following diagrams. In these cells, 2n = 4. a. anaphase of...

See similar textbooks

Related questions

Q: DNA, which is negatively charged, can adsorb onto the surface of citrate-capped Au nanoparticles.…

A: Langmuir adsorption isotherm describes the situation of equilibrium between the two systems…

Q: Mutants were isolated in which the constitutive phenotype of a missense lacl mutation was…

A: In an experiment, the mutants were isolated in which the constitutive phenotype of a missense lacI…

Q: explain how algal bloom occur and discuss its effect on the aquatic environment and species

A: The aquatic ecosystem contain different organisms, some of which are phototrophic and some others…

Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…

A: A hydropathy plot is a tool used to visualize the hydrophobicity or hydrophilicity of a protein…

Q: How many different DNA sequences could code for amino acid sequence Met-His-Leu-Thr-Trp-Lys? (Note:…

A: DNA is a hereditary molecule. It carries the genetic information that is passed from one generation…

Q: During your experiment you analysed only a few of the recombinant clones for the presence of the…

A: A Genomic library consists of the total genomic DNA of an organism. This DNA can be stored inside…

Q: The following DNA sequence is found on a chromosome in rice plants: 5’…

A: Given DNA sequence: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ Since, this is the…

Q: II. Questions for Research. 1. What are the adult derivatives of the pharyngeal pouches? 2. What is…

A: A research question is a question that a researcher asks in order to collect data that will help…

Q: ㅁㅇ PTO 어어어어어어어 In the pedigree shown, indicate whether each of the following inheritance patterns is…

A: Some genetic abnormalities have an inheritance pattern known as autosomal recessive. A gene is…

Q: Mr. Grady, a 70-year-old male with a history of arthritis, is evaluated by his rheumatologist for a…

A: The inflammatory arthritis known as gout is characterized by recurring outbreaks of red, painful,…

Q: C. In a horse population, three different traits showing continuous distribution were measured, and…

A: A measure called heritability is used in breeding and genetics to determine how much phenotypic…

Q: 10.0 8.0 6.0 5.0 4.0 3.0 2.0 1.5 1.0 0.5 MC 179 196 198 210 222 234 253 254 M נות

A: To pinpoint a specific gene's location on a chromosome, geneticists employ maps. In one kind of map,…

Q: Does DNA alterations during DNA replication result in the formation of cancerous cells? And how does…

A: DNA is the deoxyribonucleic acid, which contains the genes in the form of a sequence of nucleotides,…

Q: mul with to lower water A normal red blood cell is small and shaped like a flattened disk. The…

A: The plasma membrane of the cells including RBC perform as a semipermeable membrane. We know that…

Q: Describe the lac operon

A: Lac operon, this concept was proposed by Jacob and Monod in 1965. An operon is a functioning unit of…

Q: In eukaryotes there is not a consistent relationship between the length of the coding sequence of a…

A: DNA is 2.2 m long molecule in human beings. It is converted to mRNA via process of transcription.…

Q: In this cartoon, imagine that Romeo is a potassium ion (K+) and Juliet is a sodium ion (Na+).…

A: The plasma membrane of the cell regulates the entry and exit of different molecules according to…

Q: Plant breeders have long appreciated the phenomenon called hybrid vigor or heterosis, in which…

A: Cytoplasmic male sterility (CMS) in corn is caused by defective mitochondrial genomes that impede…

Q: Which of the following embryological events is involved in the formation of the ovarian follicles?…

A: Ovarian follicles are fluid filled follicles present in ovaries which remains in first meiotic stage…

Q: List the methods/techniques used to enhance drug solubility and briefly describe each.

A: Introduction Solubility, the phenomenon of dissolving a solute in a solvent to produce a…

Q: The movement of glucose across the plasma membrane is determined by: a. Electrochemical gradient O…

A: Plasma membrane is the selectively permeable membrane, which allows the movement of only selective…

Q: Jon performed a pour plate technique to determine the concentration of viable cells in her mother…

A: INTRODUCTION Pour plate technique This technique helps in enumerating bacterial cells in a mixed…

Q: You are studying a newly discovered gene, whose alleles code for one of two phenotypes, either…

A: Inheritance pattern is a type of pattern which determines how traits are passed on from parental…

Q: Explain the target microbes/microorganism and mode of action of the antibiotic ofloxacin

A: A quinolone antibiotic called ofloxacin is effective in treating a variety of bacterial illnesses.…

Q: why do we use EcoRI plus HindIII rather than BamHI or Sau3AI?

A: Restriction enzymes are enzymes that cut DNA at specific recognition sites. These enzymes are used…

Q: Suppose a new mutation arises in a mitochondrial genome. Explain what would have to happen in order…

A: Mitochondria is a double membrain bound cell organelle found in eukaryotic cells. It contain double…

Q: explain what does hisatmine and adetycholine mimic. within smooth muscle receptors. what do they…

A: Histamine is an important chemical that has a role in a number of different bodily processes. It…

Q: Make or create one question about Speciation and ecology (Nature of species, reproductiva isolation,…

A: When a group within a species separates from other members of its species, it develops its own…

Q: Write down the functions of the following body system. Body System Functions 1. Skeletal System…

A: Introduction The human body has 11 distinct systems, collectively referred to as organ systems,…

Q: IV 1 = female - male 2 3 11 2 4 3 ? 4 C 2 5 5 3 4 6 6 The disease trait in this pedigree is…

A: Autosomal recessive is a pattern of inheritance in which two mutated genes are inherited from each…

Q: A male has a particular X-linked recessive genetic disorder. His partner is normal, but her father…

A: Introduction Our biological parents pass on certain genetic traits to us. The term "X-linked…

Q: if the water potential of a dialysis is -4.0 and pressure potential was -2.0 and the solute is…

A: Introduction : The term "water potential" refers to the kinetic energy of water. When a solute is…

Q: According to the lab, tools are of value for a variety of reasons including____. a. providing access…

A: Prehistoric men have been using stone tools and this has been developed over millions of years.…

Q: 1 2 3 4 5 Electrons are freed. Glucose enters glycolysis. ATP is produced. Energy is invested to…

A: Every living cell in the body participates in the process of glycolysis. Ten enzyme-catalyzed…

Q: What is the lac operon?

A: The procedure of using a gene's data to generate a functioning genetic material is known as gene…

Q: Provide 2 examples of Diffusion, Osmosis, and Semi-Permeable Membrane (1 from the "Diffusion Through…

A: Diffusion and osmosis are quite similar which describes movement of substance from its a region of…

Q: mitochondrial genes affecting tRNAs. For example, one form of MELAS (mitochondrial myopathy,…

A: Mitochondrial diseases ( MELAS) are a heterogeneous group of rare genetic disease it is caused…

Q: Define Diffusion, Osmosis, and Semi-Permeable Membrane.

A: The premise that a cell is the basic building block of life underlies the study of cell biology,…

Q: The so-called hypervariable regions (HV1 and HV2) of the human mitochondrial genome are sometimes…

A: HV1 and HV2 are two hypervariable regions found in the human mitochondrial DNA (deoxyribonucleic…

Q: Hello, please read the attached Microbiology question and answer the question correctly. *If you…

A: Introduction KIA is known as Klinger's iron test. it is used to detect the carbohydrate…

Q: The structure of a typical pUC19/human DNA recombinant clone. Ensure that you clearly indicate the…

A: Plasmid vectors are circular and extra chromosomal DNA which are capable of self-replication.…

Q: 13. What is the effect of the following in the DNA isolation process: affect isolation solution…

A: DNA isolation is a process through which the intact DNA of the organisms is extracted and used for…

Q: Haemophilia A is a severe coagulation disorder that shows X-linked recessive inheritance. Red-green…

A: Hemophilia is typically an inherited bleeding disorder where the blood does not clot properly. This…

Q: Assume the DpnI digestion has failed after the PCR in the synthesis of mutated plasmid by thermal…

A: DNA that has been methylated or hemimethylated is unique to Dpn I. The majority of E. coli strains'…

Q: One of the earliest stone tool industry is the____. This is a significant development in hominin…

A: The correct option is: d. Oldowan; led to the eventual dispersal of Australopithecus out of Africa

Q: how is scanning electron microscopy unique and usefulm what makes this so important?

A: Electron microscopes use a focused beam of electrons to image the specimen while optical microscopes…

Q: What are some affordances of visual mediums?

A: Visual mediums are of many types like digital and printed images, posters, photography, graphic…

Q: The genus Homo dates back to about____. a. 3.9 million years ago b. 1.8 million years ago c. 250,000…

A: At some point between 3.0 and 2.5 million years ago, the genus Homo first appeared . The Homo…

Q: During acclimatization to altitude, lowlanders develop which of the following? Metabolic acidosis…

A: Depending upon the pH level the body fluid could be acidic or alkaline. When pH is low, the…

Q: With which kind of antibiotic (static or cidal) would you expect the MIC and MBC to be about the…

A: Introduction : MIC is the minimum inhibitory concentration of the antimicrobial agents to inhibit or…

Question

Once a healthy biological male has reached adulthood, do his cells continue to divide by both mitosis and meiosis? Outline when each type of cell division might occur.

In your answer, ensure you give details of:

the type of tissue which is produced by mitosis, and what can start this

process;

- the type of tissue which is produced by meiosis, what can start this process.

asap please

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction: Step 1

VIEW

Interpretation of the Context : Step 2

VIEW

Explanation: Mitotic Cell Division: Step 3

VIEW

Explanation: Meiosis Cell Division : Step 4

VIEW

Conclusion : Step 5

VIEW

Step by step

Solved in 5 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

In human spermatogenesis, mitosis of a stem cell gives rise to one cell that remains a stem cell and one cell that becomes a spermatogonium. Draw four rounds of mitosis for a stem cell and label; the daughter cells. For one spermatogonium, draw the cells it would produce from one round of mitosis followed by meiosis. Label the cells, and label mitosis and meiosis. What would happen if stem cells divided like spermatogonia?
What are the major differences between mitosis and meiosis? Explain this both in terms of the different steps of each event and with regards to the final products of each event. Remember to mention the events which are unique to meiosis and why they are significant.
Please explain (and simply) the process of mitosis and meiosis. What are the differences between them?
Describe one function, brought about by the process of meiosis thatspermatogenesis and oogenesis have in common. Please write the similarities between spermatogenesis and oogenesis in a paragraph ratherthan a table. Please discuss the process mentioning differentiation, multiplication anddivision. How many stages of meiosis do they go through. Please mention if haploid ordiploid cells are formed.
Assuming a cell starts off with 2 chromosomes, before entering S-phase, draw out this cell would look like, with the labeled and appropriate number of chromosomes during meiosis I. Make sure to-include labeling of stages and major events if applicable.
Please answer and explain in detail the following questions please! explain each step. THank you ! 1. Why do you think some cells use mitosis while others use meiosis? Consider the overall function of these two processes in your answer. 2. Do you agree or disagree, and why? about the question above
What are the significance of MEIOSIS. State whether it is a normal developmental phenomena or not, support your answer.
The observed chromosome is in what Mitotic or Meiotic Stage?
A diploid cell has eight chromosomes, four per set. In the followingdiagram, in what phase of mitosis, meiosis I, or meiosis II, is this cell?
In human spermatogenesis, mitosis of a stem cell gives rise to one cell that remains a stem cell and one cell that becomes a spermatogonium. (a) Draw four rounds of mitosis for a stem cell, and label the daughter cells. (b) For one spermatogonium, draw the cells it would produce from one round of mitosis followed by meiosis. Label the cells, and label mitosis and meiosis. (c) Explain what would happen if stem cells divided like spermatogonia.
Draw a cell during the steps of Meiosis I (prophase, metaphase, anaphase, and telophase). Give the cell only two pairs of chromosomes. Show crossing-over. You may insert your drawings at the end of this document, or upload them to the Canvas assignment for this lab.
Compare and contrast mitosis and meiosis in detail. Include the concept of independent assortment of chromosomes and how that contributes to the genetic variation in offspring in your discussion.