Answered: Which of the following regions within a…

Name: Which of the following regions within a mRNAsequence indicates the st
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the following regions within a mRNAsequence indicates the start of translation?O a. Termination sequenceO b. Promoter regionOO d. Start codonO e. None of the abovec. Regulatory region

Science

Biology

Which of the following regions within a mRNA sequence indicates the start of translation? O a. Termination sequence O b. Promoter region O c. Regulatory region

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 7TYU: Which of the following is/are not found in a bacterial mRNA molecule? (a) stop codon (b) upstream...

See similar textbooks

Similar questions

The portion of the mRNA transcript that gets removed duringRNA processing is thea. exons.b. introns.c. poly-A tails.d. 5′ caps.e. spliceosomes.
A mutation in a/ an _____ sequence of a gene would be associated with loss of detectable mRNA from that unit. A) promoter B) exon C) intron D) splice site E) terminator
What happens immediately after the initiation complex forms during translation? (a) peptide bond formation (b) the DNA associated with the promoter unwinds (c) the small and large subunits of the ribosome come together (d) primers are formed (e) phosphodiester bond formation
Which steps in eukaryotic translation require the cleavage of a phosphodiester bond from GTP? Choose one or more: A. release of EF–Tu B. formation of a peptide bond C. formation of the 80S ribosome D. release of the new polypeptide chain E. translocation of the ribosome along the mRNA
Which of the following help(s) to stabilize mRNA by inhibiting degradation? a. Introns b. 3'-poly(A) tail c. both the 3' cap and the 3'-poly(A) tail d. 3' cap e. exons
For translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the ribosome. b) The tRNA is the same thing as the amino acid. c) There are two binding pockets within the ribosome where different tRNAs will bind to the mRNA. d) The first codon that is recognized by the ribosome is UAG e) The ribosome can bind to the mRNA in any location.
Transcription & Translation A. Describe mRNA splicing. B.How do mRNA and rRNA interact? C.How do mRNA and tRNA interact?
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNA
Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.
During Codon recognition (a) the ribosome moves towards the 3’ end of the mRNA (b) a tautomeric shift occurs (c) a peptide bond forms (d) anticodon and codon pairing occurs (e) all of the above
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.