Which of the following is not a factor that increases mutations? a. Fast rates of replication b. Repair enzymes O c. Ionizing radiation O d. UV radiation e. Replication error
Q: TASK No 4 A patient of 48 years old complains of irritability, fatigue, weight loss with increased…
A: Pathology is the science branch in which the disease is diagnosed by means of studying the various…
Q: If the liver can produce 5 mg of albumen per day, what is its contribution to the concentration in…
A: The body's circulatory system, or blood, is a critical fluid connective tissue that carries vital…
Q: The data below illustrates the role of MutS, MutH and Dam in DNA repair. Strains of E coli that are…
A: Answer .) :- MutS and MutH are two proteins involved in the DNA mismatch repair (MMR) pathway in E.…
Q: Based on the information on page 147 Choose the best response. Lactobacillus bulgaricus O…
A: Yogurt, a widely-consumed fermented dairy product, owes its unique taste and texture to the specific…
Q: (i) A repressor binds to RPA and an activator binds to RPC 1. [Select] 2. [Select] 3. [Select]
A: Gene expression, the process by which information from a gene is used to synthesize a functional…
Q: When an error in DNA replication introduces a base-pair mismatch in a double-stranded DNA, the…
A: DNA replication is a fundamental process that ensures the accurate transmission of genetic…
Q: SDS-PAGE w/o B-mercaptoethanol LANE 1 D LANE 2 C SDS-PAGE w/ B-mercaptoethanol LANE 1 LANE 2 B C D
A: Electrophoresis is defined as the migration of charged particles under the influence of an electric…
Q: True or False: Alkalinophiles live best in acidic conditions.
A: Acidophiles, are microorganisms that thrive in acidic environments, such as acid mine drainage or…
Q: 11H Complex I (NADH:ubiquinone oxidoreductase) and complex III (coenzyme Q: cytochrome c -…
A: Iron-sulfur clusters' standard reduction potentials (E°) in biological complexes can vary, even when…
Q: 5. Anabolic steroid use can provide athletes with benefits during training and performance. Provide…
A: Anabolic steroids are also called anabolic-androgenic steroids. these category of drugs derivatives…
Q: 4. What are the two experimental variables in this experimental design? 5. What gas is collecting in…
A: The effect of temperature and food source on yeast fermentation is examined in this experimental…
Q: a basic unit of inheritance one of the main concepts in Darwin's famous theory a series of…
A: Because the genetic material is how the information from the parents is passed on to or inherited by…
Q: Name the functions, food sources, and deficiency and toxicity symptoms for your selected nutrient:
A: The body need nutrients, chemical substances found in food, to function effectively and preserve…
Q: (heterozygous) example: Tongue roll Able to Roll (R) RR (homozygous) or Rr (heterozygous)…
A: Dominant character is always expressed in homozygosity or heterozygous condition. In contrast,…
Q: Fill in the Table Broad Topic: Specific Topic: What is known: Experimental Question:…
A: This work explores single-cell level gene expression mistakes in Bacillus subtilis. The study looks…
Q: Just as DNA methylation decreases gene expression and DNA acetylation increases gene expression, is…
A: DNA methylation, histone acetylation, and protein phosphorylation are vital biological processes…
Q: Multicellular organisms with a true nucleus, histone proteins, ester-linked fatty acids in their…
A: Organelles are specialized components that carry out particular tasks and contribute to the general…
Q: 24) The following statements below concern DNA replication. One of them is not true. Identify the…
A: DNA replication is the process by which a cell makes an exact copy of its DNA. It is a fundamental…
Q: Which form of human hemoglobin may be present in some adults, but not in the embryo or the fetus?…
A: Hemoglobin is a protein found in red blood cells that is responsible for carrying oxygen throughout…
Q: PO1583 ILIA HUMAN P16598 ILIA RAT PO1582 ILIA MOUSE P18430 ILIA PIG P48089 ILIA MACMU Q28579 ILIA…
A: Multiple sequence alignment can provide insights into the evolutionary relationships, functional…
Q: A person with blue eyes is called Group of answer choices homozygous dominant heterozygous…
A: The expression of the eye colour ranges from brown to blue and virtually anything in between . This…
Q: a study to assess the strength of selection on alleles of a gene “B” which affects brightness of the…
A: In the study assessing the strength of selection on alleles of a gene "B" that affects the…
Q: Ultimately, as a tactical athlete, the goal is to maximize the strength to bodyweight ratio, and…
A: There are diverse ways to reach the correct mix of strength, speed, perseverance, and body weight…
Q: Chemicals that may be sterilants are called
A: High level germicides are a category of chemicals that have the ability to kill a wide range of…
Q: 83. Due to their low density, females of a species of turtles are having difficulty finding mates.…
A: Mate availability is a critical factor in reproductive success. When individuals fail to find mates,…
Q: Select all that apply: Which antibiotics contain a beta-lactam ring structure? O Ciprofloxacin O…
A: Antibiotics are medicines used for killing bacteria and thereby reducing bacterial infections in…
Q: What is Schistosomiasis? write a short paragraph about Schistosomiasis
A: A plant or animal that lives on, alongside, or inside a larger species and extracts nutrients is…
Q: Complete the following tasks. You are fresh recruits to a molecular biology laboratory, and your new…
A: The polymerase chain reaction (PCR) is a technique for amplifying DNA sequences in the lab. The…
Q: Suppose i want to prepare or manufacture 1 litter of hand wash, for this can you please provide me a…
A: SOP is an abbreviation for Standard Operating Procedure. It is a detailed step-by-step guide that…
Q: 2. In a river in Ontario, 351 Atlantic salmon were captured and fin-marked with numbered anchor…
A: LetM=total marked salmonN=total population of salmonm=marked and recaptured n= recaptured
Q: What type of nucleotide is not involved in oxidation-reduction reactions? ONADPH O ATP OFAD Question…
A: The nucleotide that is not involved in oxidation-reduction reactions is ATP (adenosine…
Q: The increase in fast food establishments on Kirkwood Avenue is taking a deadly toll on the squirrels…
A: Familial hypercholesterolemia (FH), an autosomal dominant genetic condition produced by mutations in…
Q: You complete a comparative transcriptomics experiment, where RNA from a plant sample grown in sandy…
A: The researchers compared the gene expression differences between plants cultivated in silty soil and…
Q: Give typing answer with explanation and conclusion . Which of the following statement is INCORRECT?…
A: The given question presents a set of statements, and our task is to identify the incorrect statement…
Q: 1. Which of the following best describes a bacterium's movement? a. Circular b. Zig-zag or random…
A: B. Zig-zag or random walk
Q: The microbes discovered in Lake Whillans and Pitch Lake represented a few of the general categories…
A: Microorganisms play crucial roles in various fields of study, including genetic engineering,…
Q: What is the most common genotype of those, in the above family, who have died from malaria?  A.)…
A: Pedigree chart: In terms of genetics, a pedigree is a diagram showing the way a trait or medical…
Q: Which of the following terms is an absolute condition? Degermation Disinfection O Sanitization O…
A: In various fields, such as healthcare, food processing, and laboratory settings, ensuring…
Q: J22. A and B are two genes located on the same chromosome. D and E are two genes located on a…
A: We are given a cross between two sets of genes found on the same chromosome (A and B) and a…
Q: It took a temperature of 135 degrees Celsius to kill all of the bacteria in a test tube in 10…
A: As more and more microbes were discovered and identified to be the cause of various infections or…
Q: Consider section J, the following is a karyotype of: 75 X » ») N 5 2 3 >= X( 11 8 X 15 6 10 13 19 14…
A: *An individual entire set of chromosomes, which are grouped and organised based on their size,…
Q: A diploid trihybrid plant was testcrossed. Each of the three genes determines a single Mendelian…
A: Let's represent the three genes as A, B and C.The two parents that were crossed to form the diploid…
Q: The human anti-bacterial protein lysozyme, consisting of a single polypeptide with 129 amino acids,…
A: In essence, a peptide bond is an amide-type covalent chemical connection. This bond connects two…
Q: True or False: Acidophiles live best in acidic conditions. True False
A: Acidophiles are organisms that are belong to all the three domains: such as Eukaryotes, Bacteria and…
Q: Scientists are working to develop gene therapy to treat Batten disease, also known as Late Infantile…
A: Batten disease is also known as neuronal ceroid lipofuscinoses. Batten disease is an autosomal…
Q: Based on the vein density results and your knowledge of how the light treatments would impact the…
A: The thylakoid membranes of chloroplasts host several metabolic processes known as the light…
Q: Hello, I need an resum or a scheme about Disorders of Coagulation that I will use to do an…
A: Title: Disorders of CoagulationIntroduction:Disorders of Coagulation are a group of medical…
Q: A 5 year old patient is presenting in a clinic. She has received a C1 complement deficiency…
A: The complement system, which consists of a cascade of proteins that aid in the identification and…
Q: Describe stepwise the pre-mRNA processing, how small noncoding RNAs regulate gene expression and…
A: A gene is made up of DNA. It is eventually transcribed into mRNA that helps in the process of…
Q: If the blue pigment traveled 1.5 cm, what is its Rf value? Round your answer to 2 decimal places.…
A: To calculate the Rf value (retention factor), you need to divide the distance traveled by the blue…
Step by step
Solved in 3 steps
- Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication forkMatch the method with the appropriate enzyme. _____ PCR a. Taq polymerase _____ cutting DNA b. DNA ligase _____ cDNA synthesis c. reverse transcriptase _____ DNA sequencing d. restriction enzyme _____ pasting DNA e. DNA polymerase (not Taq)Which of the following is/are not required for DNA replication to occur? a. DNA polymerase b. nucleotides c. template DNA d. primers e. helicase f. all are required
- Meselson and Stahl's experiments proved that DNA replicates by which mode? conservative semi-conservative dispersive none of the above#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:5' ATTTACGTTTT 3' 3' TAAATGCAAAA 5' Need help drawing a diagram showing the replication fork at the beginning of the ORI that includes the leading strands, lagging strands, snd the Okazaki fragments of the ORI template
- Indicate the stage of DNA replication when each of thefollowing enzymes is active:a. helicaseb. primasec. DNA polymerasesd. ligasee. topoisomerasef. DNA gyraseThis is the original strand of DNA: ATG AAG TTT GGC TAA Which option would represent a frameshift mutation due to deletion during replication? ATG UAA GTT TGG CTA A ATG TTT GGC TAA ATG AAG TTT GGC GCA TAA ATG AAG TTG GCT AAThis is the original strand of DNA: ATG AAG TTT GGC TAA Which option would represent a frameshift mutation due to deletion during replication? a. ATG AAG TTT GGC GCA TAA b. ATG UAA GTT TGG CTA A c. ATG TTT GGC TAA d. ATG AAG TTG GCT AA
- A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…Which DNA polymerase in prokaryotes is involved in the replacement of primers with deoxynucleotides? a.DNA-Pol I b.DNA-Pol II c.DNA-Pol Ill d.DNA-Pol IVWhich of the following replication enzymes will most likely be involved in COVID19 RNA replication? a) Helicase, Polymerase, Ligase b) SSB protein, Polymerase, Ligase c) Topoisomerase, Primase, Ligase d) Helicase, SSB protein, Primase e) Topoisomerase, Polymerase, Primase